ID: 1130170663

View in Genome Browser
Species Human (GRCh38)
Location 15:81509579-81509601
Sequence AGACAGCTCCAAGAATTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130170660_1130170663 18 Left 1130170660 15:81509538-81509560 CCTTTTTTGAGGAAAGGTAGGAG No data
Right 1130170663 15:81509579-81509601 AGACAGCTCCAAGAATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130170663 Original CRISPR AGACAGCTCCAAGAATTTCA GGG Intergenic
No off target data available for this crispr