ID: 1130170682

View in Genome Browser
Species Human (GRCh38)
Location 15:81509818-81509840
Sequence CAAGTTAGACAGAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130170682_1130170688 24 Left 1130170682 15:81509818-81509840 CCTCCCACCCTCTGTCTAACTTG No data
Right 1130170688 15:81509865-81509887 CTGGCTAATTGCTGTTCATCAGG No data
1130170682_1130170687 5 Left 1130170682 15:81509818-81509840 CCTCCCACCCTCTGTCTAACTTG No data
Right 1130170687 15:81509846-81509868 TACTAAGATATCTCAAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130170682 Original CRISPR CAAGTTAGACAGAGGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr