ID: 1130174084

View in Genome Browser
Species Human (GRCh38)
Location 15:81549263-81549285
Sequence CTTTCAACACTGCTAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130174078_1130174084 19 Left 1130174078 15:81549221-81549243 CCAAGTTTAATAATATGAAGTGT No data
Right 1130174084 15:81549263-81549285 CTTTCAACACTGCTAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130174084 Original CRISPR CTTTCAACACTGCTAGTGAG AGG Intergenic
No off target data available for this crispr