ID: 1130174948

View in Genome Browser
Species Human (GRCh38)
Location 15:81558971-81558993
Sequence TGTGTGCTCTAACCCTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130174942_1130174948 4 Left 1130174942 15:81558944-81558966 CCAAGGCTCAGCTCAATACTCCT No data
Right 1130174948 15:81558971-81558993 TGTGTGCTCTAACCCTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130174948 Original CRISPR TGTGTGCTCTAACCCTGTGG GGG Intergenic
No off target data available for this crispr