ID: 1130179936

View in Genome Browser
Species Human (GRCh38)
Location 15:81615464-81615486
Sequence TGTCCTTTTATTAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130179931_1130179936 27 Left 1130179931 15:81615414-81615436 CCAGTTTGGGGTTCTTATAGATA No data
Right 1130179936 15:81615464-81615486 TGTCCTTTTATTAAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130179936 Original CRISPR TGTCCTTTTATTAAAGAGGG AGG Intergenic
No off target data available for this crispr