ID: 1130183030

View in Genome Browser
Species Human (GRCh38)
Location 15:81651183-81651205
Sequence CTGCCCTTTCTGACTTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130183022_1130183030 13 Left 1130183022 15:81651147-81651169 CCAGGGACAAGCAGGAGCCAGGG No data
Right 1130183030 15:81651183-81651205 CTGCCCTTTCTGACTTGGGGTGG No data
1130183018_1130183030 30 Left 1130183018 15:81651130-81651152 CCAGGGACAAGCAGGAGCCAGGG No data
Right 1130183030 15:81651183-81651205 CTGCCCTTTCTGACTTGGGGTGG No data
1130183024_1130183030 -4 Left 1130183024 15:81651164-81651186 CCAGGGACAAGCATGATCCCTGC No data
Right 1130183030 15:81651183-81651205 CTGCCCTTTCTGACTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130183030 Original CRISPR CTGCCCTTTCTGACTTGGGG TGG Intergenic
No off target data available for this crispr