ID: 1130183839

View in Genome Browser
Species Human (GRCh38)
Location 15:81659446-81659468
Sequence CTGAATAAAGGCTCCTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130183834_1130183839 14 Left 1130183834 15:81659409-81659431 CCCAATTTTAGTTTGCATTTAAA No data
Right 1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG No data
1130183832_1130183839 25 Left 1130183832 15:81659398-81659420 CCCTTTTAACTCCCAATTTTAGT No data
Right 1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG No data
1130183833_1130183839 24 Left 1130183833 15:81659399-81659421 CCTTTTAACTCCCAATTTTAGTT No data
Right 1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG No data
1130183835_1130183839 13 Left 1130183835 15:81659410-81659432 CCAATTTTAGTTTGCATTTAAAA No data
Right 1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130183839 Original CRISPR CTGAATAAAGGCTCCTTCTT TGG Intergenic
No off target data available for this crispr