ID: 1130188136

View in Genome Browser
Species Human (GRCh38)
Location 15:81705266-81705288
Sequence ACTAAAATTGGGAGTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130188136_1130188141 13 Left 1130188136 15:81705266-81705288 CCCTTTTAACTCCCAATTTTAGT No data
Right 1130188141 15:81705302-81705324 CCACTGATACCTCTGAATAAAGG No data
1130188136_1130188143 25 Left 1130188136 15:81705266-81705288 CCCTTTTAACTCCCAATTTTAGT No data
Right 1130188143 15:81705314-81705336 CTGAATAAAGGCTCCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130188136 Original CRISPR ACTAAAATTGGGAGTTAAAA GGG (reversed) Intergenic