ID: 1130188137

View in Genome Browser
Species Human (GRCh38)
Location 15:81705267-81705289
Sequence AACTAAAATTGGGAGTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130188137_1130188143 24 Left 1130188137 15:81705267-81705289 CCTTTTAACTCCCAATTTTAGTT No data
Right 1130188143 15:81705314-81705336 CTGAATAAAGGCTCCTTCTTTGG No data
1130188137_1130188141 12 Left 1130188137 15:81705267-81705289 CCTTTTAACTCCCAATTTTAGTT No data
Right 1130188141 15:81705302-81705324 CCACTGATACCTCTGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130188137 Original CRISPR AACTAAAATTGGGAGTTAAA AGG (reversed) Intergenic