ID: 1130188137 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:81705267-81705289 |
Sequence | AACTAAAATTGGGAGTTAAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1130188137_1130188143 | 24 | Left | 1130188137 | 15:81705267-81705289 | CCTTTTAACTCCCAATTTTAGTT | No data | ||
Right | 1130188143 | 15:81705314-81705336 | CTGAATAAAGGCTCCTTCTTTGG | No data | ||||
1130188137_1130188141 | 12 | Left | 1130188137 | 15:81705267-81705289 | CCTTTTAACTCCCAATTTTAGTT | No data | ||
Right | 1130188141 | 15:81705302-81705324 | CCACTGATACCTCTGAATAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1130188137 | Original CRISPR | AACTAAAATTGGGAGTTAAA AGG (reversed) | Intergenic | ||