ID: 1130188139

View in Genome Browser
Species Human (GRCh38)
Location 15:81705278-81705300
Sequence TTTTAAATGCAAACTAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130188139_1130188143 13 Left 1130188139 15:81705278-81705300 CCAATTTTAGTTTGCATTTAAAA No data
Right 1130188143 15:81705314-81705336 CTGAATAAAGGCTCCTTCTTTGG No data
1130188139_1130188141 1 Left 1130188139 15:81705278-81705300 CCAATTTTAGTTTGCATTTAAAA No data
Right 1130188141 15:81705302-81705324 CCACTGATACCTCTGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130188139 Original CRISPR TTTTAAATGCAAACTAAAAT TGG (reversed) Intergenic
No off target data available for this crispr