ID: 1130188141

View in Genome Browser
Species Human (GRCh38)
Location 15:81705302-81705324
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130188138_1130188141 2 Left 1130188138 15:81705277-81705299 CCCAATTTTAGTTTGCATTTAAA No data
Right 1130188141 15:81705302-81705324 CCACTGATACCTCTGAATAAAGG No data
1130188136_1130188141 13 Left 1130188136 15:81705266-81705288 CCCTTTTAACTCCCAATTTTAGT No data
Right 1130188141 15:81705302-81705324 CCACTGATACCTCTGAATAAAGG No data
1130188137_1130188141 12 Left 1130188137 15:81705267-81705289 CCTTTTAACTCCCAATTTTAGTT No data
Right 1130188141 15:81705302-81705324 CCACTGATACCTCTGAATAAAGG No data
1130188139_1130188141 1 Left 1130188139 15:81705278-81705300 CCAATTTTAGTTTGCATTTAAAA No data
Right 1130188141 15:81705302-81705324 CCACTGATACCTCTGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130188141 Original CRISPR CCACTGATACCTCTGAATAA AGG Intergenic