ID: 1130192220

View in Genome Browser
Species Human (GRCh38)
Location 15:81748385-81748407
Sequence TGTTTCTACAAGGCCAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130192220_1130192222 -2 Left 1130192220 15:81748385-81748407 CCTCTATTGGCCTTGTAGAAACA No data
Right 1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG No data
1130192220_1130192228 13 Left 1130192220 15:81748385-81748407 CCTCTATTGGCCTTGTAGAAACA No data
Right 1130192228 15:81748421-81748443 CTGACAGGACCACATGGCAGAGG No data
1130192220_1130192229 20 Left 1130192220 15:81748385-81748407 CCTCTATTGGCCTTGTAGAAACA No data
Right 1130192229 15:81748428-81748450 GACCACATGGCAGAGGACAGCGG No data
1130192220_1130192230 21 Left 1130192220 15:81748385-81748407 CCTCTATTGGCCTTGTAGAAACA No data
Right 1130192230 15:81748429-81748451 ACCACATGGCAGAGGACAGCGGG No data
1130192220_1130192227 7 Left 1130192220 15:81748385-81748407 CCTCTATTGGCCTTGTAGAAACA No data
Right 1130192227 15:81748415-81748437 CTGCTGCTGACAGGACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130192220 Original CRISPR TGTTTCTACAAGGCCAATAG AGG (reversed) Intergenic
No off target data available for this crispr