ID: 1130192222

View in Genome Browser
Species Human (GRCh38)
Location 15:81748406-81748428
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130192220_1130192222 -2 Left 1130192220 15:81748385-81748407 CCTCTATTGGCCTTGTAGAAACA No data
Right 1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130192222 Original CRISPR CACCCTTCCCTGCTGCTGAC AGG Intergenic
No off target data available for this crispr