ID: 1130193896

View in Genome Browser
Species Human (GRCh38)
Location 15:81761268-81761290
Sequence TATTATCTGTAGAACGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130193896_1130193901 -2 Left 1130193896 15:81761268-81761290 CCATCCCCGTTCTACAGATAATA No data
Right 1130193901 15:81761289-81761311 TAAGACTGAGGAATAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130193896 Original CRISPR TATTATCTGTAGAACGGGGA TGG (reversed) Intergenic
No off target data available for this crispr