ID: 1130199123

View in Genome Browser
Species Human (GRCh38)
Location 15:81808848-81808870
Sequence CACCAGAACTTGCATCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130199123_1130199129 24 Left 1130199123 15:81808848-81808870 CCCTGAGGATGCAAGTTCTGGTG No data
Right 1130199129 15:81808895-81808917 ATCAGCTACTGTTAGCAATAGGG No data
1130199123_1130199130 27 Left 1130199123 15:81808848-81808870 CCCTGAGGATGCAAGTTCTGGTG No data
Right 1130199130 15:81808898-81808920 AGCTACTGTTAGCAATAGGGAGG No data
1130199123_1130199127 -10 Left 1130199123 15:81808848-81808870 CCCTGAGGATGCAAGTTCTGGTG No data
Right 1130199127 15:81808861-81808883 AGTTCTGGTGGGATACAGACAGG No data
1130199123_1130199128 23 Left 1130199123 15:81808848-81808870 CCCTGAGGATGCAAGTTCTGGTG No data
Right 1130199128 15:81808894-81808916 CATCAGCTACTGTTAGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130199123 Original CRISPR CACCAGAACTTGCATCCTCA GGG (reversed) Intergenic
No off target data available for this crispr