ID: 1130200974

View in Genome Browser
Species Human (GRCh38)
Location 15:81826510-81826532
Sequence TCACATCAACGGGTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130200974_1130200979 26 Left 1130200974 15:81826510-81826532 CCATGCACCACCCGTTGATGTGA No data
Right 1130200979 15:81826559-81826581 AACCGAGAAGATCAGAGCCTTGG No data
1130200974_1130200980 27 Left 1130200974 15:81826510-81826532 CCATGCACCACCCGTTGATGTGA No data
Right 1130200980 15:81826560-81826582 ACCGAGAAGATCAGAGCCTTGGG No data
1130200974_1130200982 28 Left 1130200974 15:81826510-81826532 CCATGCACCACCCGTTGATGTGA No data
Right 1130200982 15:81826561-81826583 CCGAGAAGATCAGAGCCTTGGGG No data
1130200974_1130200983 29 Left 1130200974 15:81826510-81826532 CCATGCACCACCCGTTGATGTGA No data
Right 1130200983 15:81826562-81826584 CGAGAAGATCAGAGCCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130200974 Original CRISPR TCACATCAACGGGTGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr