ID: 1130201114

View in Genome Browser
Species Human (GRCh38)
Location 15:81827731-81827753
Sequence CATCCAGAAGGGTCCCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130201108_1130201114 -7 Left 1130201108 15:81827715-81827737 CCGGTACCCCAGCTTTCATCCAG No data
Right 1130201114 15:81827731-81827753 CATCCAGAAGGGTCCCGAGCAGG No data
1130201106_1130201114 -1 Left 1130201106 15:81827709-81827731 CCACTCCCGGTACCCCAGCTTTC No data
Right 1130201114 15:81827731-81827753 CATCCAGAAGGGTCCCGAGCAGG No data
1130201107_1130201114 -6 Left 1130201107 15:81827714-81827736 CCCGGTACCCCAGCTTTCATCCA No data
Right 1130201114 15:81827731-81827753 CATCCAGAAGGGTCCCGAGCAGG No data
1130201105_1130201114 0 Left 1130201105 15:81827708-81827730 CCCACTCCCGGTACCCCAGCTTT No data
Right 1130201114 15:81827731-81827753 CATCCAGAAGGGTCCCGAGCAGG No data
1130201104_1130201114 11 Left 1130201104 15:81827697-81827719 CCAAAAAATCACCCACTCCCGGT No data
Right 1130201114 15:81827731-81827753 CATCCAGAAGGGTCCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130201114 Original CRISPR CATCCAGAAGGGTCCCGAGC AGG Intergenic