ID: 1130203359

View in Genome Browser
Species Human (GRCh38)
Location 15:81853630-81853652
Sequence TACCTAAAACAACCCCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130203354_1130203359 21 Left 1130203354 15:81853586-81853608 CCTTAACTTAGAGAACTGCCTTT No data
Right 1130203359 15:81853630-81853652 TACCTAAAACAACCCCAAAAGGG No data
1130203355_1130203359 3 Left 1130203355 15:81853604-81853626 CCTTTCAGACACCAGCTTTTTGC No data
Right 1130203359 15:81853630-81853652 TACCTAAAACAACCCCAAAAGGG No data
1130203356_1130203359 -8 Left 1130203356 15:81853615-81853637 CCAGCTTTTTGCCACTACCTAAA No data
Right 1130203359 15:81853630-81853652 TACCTAAAACAACCCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130203359 Original CRISPR TACCTAAAACAACCCCAAAA GGG Intergenic
No off target data available for this crispr