ID: 1130206886

View in Genome Browser
Species Human (GRCh38)
Location 15:81885351-81885373
Sequence GTGGAATGGGTCAGTCCTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130206886_1130206890 -6 Left 1130206886 15:81885351-81885373 CCGATAGGACTGACCCATTCCAC No data
Right 1130206890 15:81885368-81885390 TTCCACAGATCATGTGTTCAGGG No data
1130206886_1130206894 29 Left 1130206886 15:81885351-81885373 CCGATAGGACTGACCCATTCCAC No data
Right 1130206894 15:81885403-81885425 TAGATAAGACAGACCTAACTAGG No data
1130206886_1130206889 -7 Left 1130206886 15:81885351-81885373 CCGATAGGACTGACCCATTCCAC No data
Right 1130206889 15:81885367-81885389 ATTCCACAGATCATGTGTTCAGG No data
1130206886_1130206891 -5 Left 1130206886 15:81885351-81885373 CCGATAGGACTGACCCATTCCAC No data
Right 1130206891 15:81885369-81885391 TCCACAGATCATGTGTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130206886 Original CRISPR GTGGAATGGGTCAGTCCTAT CGG (reversed) Intergenic
No off target data available for this crispr