ID: 1130211720

View in Genome Browser
Species Human (GRCh38)
Location 15:81929799-81929821
Sequence TGACCCCTGTTAAAAACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211720_1130211724 27 Left 1130211720 15:81929799-81929821 CCACATGTTTTTAACAGGGGTCA No data
Right 1130211724 15:81929849-81929871 GGTAAATATTTTATTCTTTGTGG No data
1130211720_1130211722 -2 Left 1130211720 15:81929799-81929821 CCACATGTTTTTAACAGGGGTCA No data
Right 1130211722 15:81929820-81929842 CAGTACACTTCTTCTGTAAAGGG No data
1130211720_1130211721 -3 Left 1130211720 15:81929799-81929821 CCACATGTTTTTAACAGGGGTCA No data
Right 1130211721 15:81929819-81929841 TCAGTACACTTCTTCTGTAAAGG No data
1130211720_1130211723 6 Left 1130211720 15:81929799-81929821 CCACATGTTTTTAACAGGGGTCA No data
Right 1130211723 15:81929828-81929850 TTCTTCTGTAAAGGGCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211720 Original CRISPR TGACCCCTGTTAAAAACATG TGG (reversed) Intergenic
No off target data available for this crispr