ID: 1130211808

View in Genome Browser
Species Human (GRCh38)
Location 15:81930834-81930856
Sequence GTAGACTTGGTTGGGTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211808_1130211817 30 Left 1130211808 15:81930834-81930856 CCGCTGCACCCAACCAAGTCTAC No data
Right 1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG No data
1130211808_1130211815 23 Left 1130211808 15:81930834-81930856 CCGCTGCACCCAACCAAGTCTAC No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211808_1130211814 22 Left 1130211808 15:81930834-81930856 CCGCTGCACCCAACCAAGTCTAC No data
Right 1130211814 15:81930879-81930901 CACTGCCAGTGAACTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211808 Original CRISPR GTAGACTTGGTTGGGTGCAG CGG (reversed) Intergenic