ID: 1130211809

View in Genome Browser
Species Human (GRCh38)
Location 15:81930842-81930864
Sequence CTGCTAAAGTAGACTTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211809_1130211815 15 Left 1130211809 15:81930842-81930864 CCCAACCAAGTCTACTTTAGCAG No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211809_1130211814 14 Left 1130211809 15:81930842-81930864 CCCAACCAAGTCTACTTTAGCAG No data
Right 1130211814 15:81930879-81930901 CACTGCCAGTGAACTGCACGTGG No data
1130211809_1130211817 22 Left 1130211809 15:81930842-81930864 CCCAACCAAGTCTACTTTAGCAG No data
Right 1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211809 Original CRISPR CTGCTAAAGTAGACTTGGTT GGG (reversed) Intergenic
No off target data available for this crispr