ID: 1130211810

View in Genome Browser
Species Human (GRCh38)
Location 15:81930843-81930865
Sequence GCTGCTAAAGTAGACTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211810_1130211814 13 Left 1130211810 15:81930843-81930865 CCAACCAAGTCTACTTTAGCAGC No data
Right 1130211814 15:81930879-81930901 CACTGCCAGTGAACTGCACGTGG No data
1130211810_1130211817 21 Left 1130211810 15:81930843-81930865 CCAACCAAGTCTACTTTAGCAGC No data
Right 1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG No data
1130211810_1130211815 14 Left 1130211810 15:81930843-81930865 CCAACCAAGTCTACTTTAGCAGC No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211810 Original CRISPR GCTGCTAAAGTAGACTTGGT TGG (reversed) Intergenic