ID: 1130211811

View in Genome Browser
Species Human (GRCh38)
Location 15:81930847-81930869
Sequence CGAGGCTGCTAAAGTAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211811_1130211817 17 Left 1130211811 15:81930847-81930869 CCAAGTCTACTTTAGCAGCCTCG No data
Right 1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG No data
1130211811_1130211815 10 Left 1130211811 15:81930847-81930869 CCAAGTCTACTTTAGCAGCCTCG No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211811_1130211814 9 Left 1130211811 15:81930847-81930869 CCAAGTCTACTTTAGCAGCCTCG No data
Right 1130211814 15:81930879-81930901 CACTGCCAGTGAACTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211811 Original CRISPR CGAGGCTGCTAAAGTAGACT TGG (reversed) Intergenic
No off target data available for this crispr