ID: 1130211812

View in Genome Browser
Species Human (GRCh38)
Location 15:81930865-81930887
Sequence CTGGCAGTGACATTGCGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211812_1130211818 14 Left 1130211812 15:81930865-81930887 CCTCGCCGCAATGTCACTGCCAG No data
Right 1130211818 15:81930902-81930924 GAGACAGGCACTGACACCCATGG No data
1130211812_1130211815 -8 Left 1130211812 15:81930865-81930887 CCTCGCCGCAATGTCACTGCCAG No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211812_1130211817 -1 Left 1130211812 15:81930865-81930887 CCTCGCCGCAATGTCACTGCCAG No data
Right 1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG No data
1130211812_1130211814 -9 Left 1130211812 15:81930865-81930887 CCTCGCCGCAATGTCACTGCCAG No data
Right 1130211814 15:81930879-81930901 CACTGCCAGTGAACTGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211812 Original CRISPR CTGGCAGTGACATTGCGGCG AGG (reversed) Intergenic