ID: 1130211813

View in Genome Browser
Species Human (GRCh38)
Location 15:81930870-81930892
Sequence GTTCACTGGCAGTGACATTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211813_1130211817 -6 Left 1130211813 15:81930870-81930892 CCGCAATGTCACTGCCAGTGAAC No data
Right 1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG No data
1130211813_1130211818 9 Left 1130211813 15:81930870-81930892 CCGCAATGTCACTGCCAGTGAAC No data
Right 1130211818 15:81930902-81930924 GAGACAGGCACTGACACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211813 Original CRISPR GTTCACTGGCAGTGACATTG CGG (reversed) Intergenic
No off target data available for this crispr