ID: 1130211815

View in Genome Browser
Species Human (GRCh38)
Location 15:81930880-81930902
Sequence ACTGCCAGTGAACTGCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130211808_1130211815 23 Left 1130211808 15:81930834-81930856 CCGCTGCACCCAACCAAGTCTAC No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211812_1130211815 -8 Left 1130211812 15:81930865-81930887 CCTCGCCGCAATGTCACTGCCAG No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211809_1130211815 15 Left 1130211809 15:81930842-81930864 CCCAACCAAGTCTACTTTAGCAG No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211810_1130211815 14 Left 1130211810 15:81930843-81930865 CCAACCAAGTCTACTTTAGCAGC No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data
1130211811_1130211815 10 Left 1130211811 15:81930847-81930869 CCAAGTCTACTTTAGCAGCCTCG No data
Right 1130211815 15:81930880-81930902 ACTGCCAGTGAACTGCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130211815 Original CRISPR ACTGCCAGTGAACTGCACGT GGG Intergenic
No off target data available for this crispr