ID: 1130212747

View in Genome Browser
Species Human (GRCh38)
Location 15:81940590-81940612
Sequence CTTTGGGGGAAATCCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130212738_1130212747 30 Left 1130212738 15:81940537-81940559 CCATCACAGAATAAGAGCTCATT No data
Right 1130212747 15:81940590-81940612 CTTTGGGGGAAATCCAAGCCTGG No data
1130212740_1130212747 -1 Left 1130212740 15:81940568-81940590 CCAGTCACAAATTTCCCACAATC No data
Right 1130212747 15:81940590-81940612 CTTTGGGGGAAATCCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130212747 Original CRISPR CTTTGGGGGAAATCCAAGCC TGG Intergenic
No off target data available for this crispr