ID: 1130213313

View in Genome Browser
Species Human (GRCh38)
Location 15:81945923-81945945
Sequence GCCACTAGTTATATTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130213309_1130213313 0 Left 1130213309 15:81945900-81945922 CCAAATTCCCTTCATTTTTTAAG No data
Right 1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG No data
1130213312_1130213313 -8 Left 1130213312 15:81945908-81945930 CCTTCATTTTTTAAGGCCACTAG No data
Right 1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG No data
1130213311_1130213313 -7 Left 1130213311 15:81945907-81945929 CCCTTCATTTTTTAAGGCCACTA No data
Right 1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG No data
1130213307_1130213313 5 Left 1130213307 15:81945895-81945917 CCCGGCCAAATTCCCTTCATTTT No data
Right 1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG No data
1130213306_1130213313 10 Left 1130213306 15:81945890-81945912 CCGCACCCGGCCAAATTCCCTTC No data
Right 1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG No data
1130213308_1130213313 4 Left 1130213308 15:81945896-81945918 CCGGCCAAATTCCCTTCATTTTT No data
Right 1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG No data
1130213305_1130213313 13 Left 1130213305 15:81945887-81945909 CCACCGCACCCGGCCAAATTCCC No data
Right 1130213313 15:81945923-81945945 GCCACTAGTTATATTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130213313 Original CRISPR GCCACTAGTTATATTGAATC AGG Intergenic
No off target data available for this crispr