ID: 1130215693

View in Genome Browser
Species Human (GRCh38)
Location 15:81966874-81966896
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130215691_1130215693 23 Left 1130215691 15:81966828-81966850 CCACTTAACTGTTTGGCTACAAC No data
Right 1130215693 15:81966874-81966896 CTACATAAACAAATGTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130215693 Original CRISPR CTACATAAACAAATGTAAAT GGG Intergenic
No off target data available for this crispr