ID: 1130221954

View in Genome Browser
Species Human (GRCh38)
Location 15:82027026-82027048
Sequence TCTGATCAGCATGATGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130221954_1130221955 -4 Left 1130221954 15:82027026-82027048 CCAATGGCATCATGCTGATCAGA No data
Right 1130221955 15:82027045-82027067 CAGACATGACCAGCAAGAGCTGG No data
1130221954_1130221957 19 Left 1130221954 15:82027026-82027048 CCAATGGCATCATGCTGATCAGA No data
Right 1130221957 15:82027068-82027090 CTAGTACTCCAGAGCTCCAGAGG No data
1130221954_1130221959 29 Left 1130221954 15:82027026-82027048 CCAATGGCATCATGCTGATCAGA No data
Right 1130221959 15:82027078-82027100 AGAGCTCCAGAGGTCTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130221954 Original CRISPR TCTGATCAGCATGATGCCAT TGG (reversed) Intergenic
No off target data available for this crispr