ID: 1130221956

View in Genome Browser
Species Human (GRCh38)
Location 15:82027054-82027076
Sequence GAGTACTAGCCAGCTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130221956_1130221962 26 Left 1130221956 15:82027054-82027076 CCAGCAAGAGCTGGCTAGTACTC No data
Right 1130221962 15:82027103-82027125 AGACATTTGCAATCTAGAGGTGG No data
1130221956_1130221957 -9 Left 1130221956 15:82027054-82027076 CCAGCAAGAGCTGGCTAGTACTC No data
Right 1130221957 15:82027068-82027090 CTAGTACTCCAGAGCTCCAGAGG No data
1130221956_1130221959 1 Left 1130221956 15:82027054-82027076 CCAGCAAGAGCTGGCTAGTACTC No data
Right 1130221959 15:82027078-82027100 AGAGCTCCAGAGGTCTTACAAGG No data
1130221956_1130221961 23 Left 1130221956 15:82027054-82027076 CCAGCAAGAGCTGGCTAGTACTC No data
Right 1130221961 15:82027100-82027122 GTAAGACATTTGCAATCTAGAGG No data
1130221956_1130221963 27 Left 1130221956 15:82027054-82027076 CCAGCAAGAGCTGGCTAGTACTC No data
Right 1130221963 15:82027104-82027126 GACATTTGCAATCTAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130221956 Original CRISPR GAGTACTAGCCAGCTCTTGC TGG (reversed) Intergenic
No off target data available for this crispr