ID: 1130221957

View in Genome Browser
Species Human (GRCh38)
Location 15:82027068-82027090
Sequence CTAGTACTCCAGAGCTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130221956_1130221957 -9 Left 1130221956 15:82027054-82027076 CCAGCAAGAGCTGGCTAGTACTC No data
Right 1130221957 15:82027068-82027090 CTAGTACTCCAGAGCTCCAGAGG No data
1130221954_1130221957 19 Left 1130221954 15:82027026-82027048 CCAATGGCATCATGCTGATCAGA No data
Right 1130221957 15:82027068-82027090 CTAGTACTCCAGAGCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130221957 Original CRISPR CTAGTACTCCAGAGCTCCAG AGG Intergenic
No off target data available for this crispr