ID: 1130223691

View in Genome Browser
Species Human (GRCh38)
Location 15:82043126-82043148
Sequence GCTGCTAGTGCGCACCGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130223691_1130223697 23 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223691_1130223698 28 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 78
1130223691_1130223696 8 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223691_1130223694 4 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130223691 Original CRISPR GCTGCTAGTGCGCACCGTGC TGG (reversed) Exonic
902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG + Intronic
903788325 1:25875656-25875678 GCTGCTTGTGCGCGGCGGGCGGG - Intergenic
907442868 1:54489396-54489418 GCAGCAAGTCCGCACCGAGCCGG + Intergenic
914958839 1:152188765-152188787 CCTGCAAGTGCGCCCCCTGCTGG - Intergenic
922897057 1:229108689-229108711 GGTGCTGGTGTGCACTGTGCAGG - Intergenic
1062786478 10:269520-269542 GCTGCTAGTGGGCATGTTGCAGG - Intergenic
1062799633 10:369518-369540 GCTGTCCGTGCTCACCGTGCAGG - Exonic
1074024031 10:109615307-109615329 TCTGCTATTGAGCACTGTGCTGG - Intergenic
1084546836 11:69818897-69818919 GCTGCTACTGCTCAGCCTGCTGG - Exonic
1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG + Exonic
1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG + Intergenic
1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG + Exonic
1096895001 12:54812603-54812625 GGTACAAGTGCACACCGTGCAGG + Intergenic
1099113041 12:78586838-78586860 GCTGCTTGTGCACACCTTGTGGG - Intergenic
1105418428 13:20232434-20232456 GCGGCTAGTGCGCCCCGGGTAGG - Intergenic
1118262506 14:64260581-64260603 GCAGCTAGTGCTCACCCTCCTGG - Exonic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1131399703 15:92114482-92114504 GTTGCTAATGTGCCCCGTGCAGG - Intronic
1133738731 16:8635253-8635275 GATGCTAGCGAGCCCCGTGCCGG - Exonic
1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG + Intergenic
1138387771 16:56647994-56648016 GCTGCCAGTGCGCACCCTGGGGG - Intronic
1143114783 17:4576366-4576388 TGTCCTAGTGGGCACCGTGCAGG + Intergenic
1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG + Intronic
1154218579 18:12433204-12433226 GCTGCTCGTGCGCAGGGTCCGGG + Intergenic
1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG + Intronic
1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG + Exonic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG + Intergenic
932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG + Intronic
936451693 2:112638549-112638571 CCTGCCAGGGCCCACCGTGCAGG + Intergenic
1174568114 20:51481559-51481581 GCTTCTAGTGCACACCGTGAAGG + Intronic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG + Intronic
953667848 3:44938833-44938855 GCTACAAGTGAGCACCGTGGTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG + Intronic
958827024 3:99042307-99042329 GGTGCTAGTGTGCACCATCCTGG + Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG + Intergenic
974386079 4:61202491-61202513 GCTGGTAGTGGGCACTGGGCGGG + Intronic
988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG + Intergenic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
999424951 5:151479455-151479477 CCTGTTTGTGCGCACAGTGCTGG + Exonic
1018926540 6:168210885-168210907 GCTGCAAGTGCACACCCAGCTGG - Intergenic
1019216516 6:170447360-170447382 GCTGCTGGTGCGGGCCCTGCCGG + Intergenic
1019603499 7:1897090-1897112 GCTGCACGGGGGCACCGTGCCGG - Intronic
1021195409 7:17668739-17668761 GGTGCATGTGCGCAACGTGCAGG - Intergenic
1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG + Exonic
1025720475 7:64007274-64007296 GGTGCTTGTGCACAACGTGCAGG + Intergenic
1025908466 7:65808455-65808477 GGTGCTGCTGAGCACCGTGCAGG - Intergenic
1025980617 7:66402283-66402305 GGTGCTGCTGAGCACCGTGCAGG + Intronic
1034964663 7:155383794-155383816 GCTGCTAGTGCTGCCTGTGCAGG + Intronic
1041172820 8:55162306-55162328 GCTGCTACTCTGCACAGTGCTGG - Intronic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic
1189893057 X:45625671-45625693 GCTACAAGTGCACAACGTGCAGG + Intergenic
1192965466 X:76172725-76172747 GGTGCTAGGGCGCAGAGTGCAGG - Intergenic
1201542435 Y:15120785-15120807 GCTACTTGTGCACAACGTGCAGG + Intergenic