ID: 1130223694

View in Genome Browser
Species Human (GRCh38)
Location 15:82043153-82043175
Sequence GCTGCCTTTAAGAAAAGATG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 271}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130223690_1130223694 5 Left 1130223690 15:82043125-82043147 CCCAGCACGGTGCGCACTAGCAG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271
1130223685_1130223694 13 Left 1130223685 15:82043117-82043139 CCCCTTCCCCCAGCACGGTGCGC 0: 1
1: 0
2: 4
3: 15
4: 190
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271
1130223684_1130223694 14 Left 1130223684 15:82043116-82043138 CCCCCTTCCCCCAGCACGGTGCG 0: 1
1: 0
2: 4
3: 13
4: 241
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271
1130223686_1130223694 12 Left 1130223686 15:82043118-82043140 CCCTTCCCCCAGCACGGTGCGCA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271
1130223689_1130223694 6 Left 1130223689 15:82043124-82043146 CCCCAGCACGGTGCGCACTAGCA 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271
1130223687_1130223694 11 Left 1130223687 15:82043119-82043141 CCTTCCCCCAGCACGGTGCGCAC 0: 1
1: 1
2: 0
3: 14
4: 184
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271
1130223691_1130223694 4 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271
1130223688_1130223694 7 Left 1130223688 15:82043123-82043145 CCCCCAGCACGGTGCGCACTAGC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG 0: 1
1: 0
2: 1
3: 14
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130223694 Original CRISPR GCTGCCTTTAAGAAAAGATG CGG Exonic
901615687 1:10537663-10537685 GCTGCGTTTGAGAGAAAATGAGG - Intronic
901789773 1:11648042-11648064 TCTGCCTTTAGTAAAGGATGGGG + Intergenic
901895261 1:12306514-12306536 GATGCCTTTAAGAAGTGATTTGG + Intronic
902687934 1:18091044-18091066 GCTGCCTGTGAGAAGGGATGGGG + Intergenic
902905557 1:19554138-19554160 GCTGGTTTTAAGAGAAGATAAGG + Intergenic
903230428 1:21919028-21919050 CCTGCCTTTGGGGAAAGATGGGG - Intronic
904079843 1:27865172-27865194 GCAGTCTTTAAAAAAAAATGTGG + Intergenic
907061135 1:51426644-51426666 GATGGCATTAAGAAAAGATGAGG + Intronic
907071726 1:51541663-51541685 GCTGCCTTTCTGCAAGGATGAGG + Intergenic
907921705 1:58919951-58919973 GATGCCTTTATAAAAAGAAGGGG - Intergenic
907992978 1:59600843-59600865 TCTGCCTTTAAGATAAGATATGG + Intronic
909642787 1:77886533-77886555 GCAGCATTTAAGAAGAGATCGGG + Intergenic
910704263 1:90110071-90110093 GCTGCCACTAAAAAAGGATGAGG - Intergenic
910833457 1:91483655-91483677 GGGGCCTTTAAGAAACGATTAGG - Intergenic
911388043 1:97202558-97202580 GCTGCCTTTGAGAAAATACTTGG - Intronic
912879607 1:113396967-113396989 GCTGCATTTTAGAAAGGATTTGG + Intronic
916372194 1:164110718-164110740 TCTGCCTTCAGGAAAAGAAGAGG - Intergenic
917354413 1:174111400-174111422 GGTGCCTTTAAGAAGTGATTGGG + Intergenic
918994727 1:191742535-191742557 GCAGCTTTTAAGAAGAAATGTGG + Intergenic
919084794 1:192909321-192909343 ACTGAGTTTAAGAACAGATGAGG + Intergenic
921369476 1:214406864-214406886 GTTGCCTTTAGGAAGAGATCAGG - Intronic
921819901 1:219605212-219605234 GCTGCCTTAAAGAAAAAAACTGG - Intergenic
1064185665 10:13159876-13159898 GGTGACTTTGAGAAAAGAAGTGG - Intergenic
1064527774 10:16275877-16275899 GCTGCCTATTATAAAAGATGGGG - Intergenic
1065186745 10:23175682-23175704 GCCAACTTGAAGAAAAGATGAGG + Intergenic
1066092585 10:32039948-32039970 GCTGCTGTTAATAATAGATGTGG - Intronic
1067097184 10:43309509-43309531 GCTGGCTTTAGGAAAGGAGGTGG - Intergenic
1067977051 10:51038173-51038195 GCAAACTTTAAGAAAAGTTGTGG + Intronic
1068282415 10:54891816-54891838 GCTGGCTGTAAAAAAAAATGAGG - Intronic
1069001239 10:63268557-63268579 ACTGCCTTTTATAAAAGATCTGG - Intronic
1070257059 10:74822022-74822044 GCTGCCTTTATGAACAGCTGGGG - Intergenic
1070359568 10:75674063-75674085 GCTGTCTTTGAGAAAATATATGG + Intronic
1070895141 10:79976962-79976984 GCTGCCATCAAGAGAAAATGAGG - Intronic
1072911876 10:99509379-99509401 GTTGCTTTTAAGAATTGATGTGG - Intergenic
1073116937 10:101096581-101096603 GCTGCTTTCCAGCAAAGATGCGG + Intronic
1073339840 10:102736156-102736178 ACTGCCTTGAAGAGAAGGTGGGG + Intronic
1073613654 10:104970497-104970519 GCTGCCCTTGAGAAAACCTGAGG - Intronic
1075593531 10:123710241-123710263 GTTGACATTAAAAAAAGATGGGG - Intronic
1076128950 10:127998611-127998633 GCTGCACATAAGAAAAGACGTGG + Intronic
1076545001 10:131239212-131239234 GCTGCATTCAAGCAAAGGTGTGG - Intronic
1080459571 11:32441421-32441443 CCTGCTTTAAAAAAAAGATGGGG - Intergenic
1082922758 11:58513667-58513689 GGTGCCATTAAGAAATGATGAGG - Intergenic
1084416135 11:69033913-69033935 GCTGCCTTTAAGACATCGTGGGG + Intergenic
1084643954 11:70443571-70443593 TCTGCCTTAAAAAAAAAATGTGG - Intergenic
1085032025 11:73277691-73277713 GCTGCCCCTTATAAAAGATGCGG - Intronic
1085055507 11:73401287-73401309 GATGCCTTTAAGTCAGGATGGGG + Intronic
1087065994 11:94028552-94028574 ACTGCCTTAAAGACAAGATGGGG - Intronic
1087262913 11:96030739-96030761 GCTGCCTTTAAGTAGAGTTCTGG - Intronic
1088815484 11:113417951-113417973 CCTGGCTTTGAGAAAAGCTGGGG + Intronic
1091762591 12:3097038-3097060 GCTGCCTTTCCCAAAAGAGGTGG + Intronic
1092337468 12:7646036-7646058 GCTGCCTGTTAGAAAAGAAATGG - Intergenic
1092677446 12:10936945-10936967 TCTCCCCTTAAAAAAAGATGAGG - Intronic
1094742373 12:33304392-33304414 GCTGACTTTGAGAAGAGATTCGG + Intergenic
1095689032 12:45067129-45067151 ACTGCCACTAGGAAAAGATGGGG + Intergenic
1096678186 12:53236860-53236882 ACTCCTTTGAAGAAAAGATGTGG + Intergenic
1099692444 12:85975426-85975448 GCTACCTTTAAAAACATATGAGG + Exonic
1099806020 12:87519433-87519455 GTTGCCTTTAAGAAGTGATTAGG - Intergenic
1101168504 12:102063405-102063427 TCTGCCTGTCAGAAAAGGTGGGG + Intergenic
1101857689 12:108457510-108457532 GCAGCCTTTGAAAAAAGATAAGG - Intergenic
1102403060 12:112647667-112647689 GTTACCTTTGAGCAAAGATGTGG + Intronic
1103020090 12:117526745-117526767 GCTGCCTTCAAAAGAATATGTGG - Intronic
1106413542 13:29527361-29527383 TCCACCTTTAAGAAAAGATTGGG + Intronic
1106575894 13:30974501-30974523 GCTGCCTGTATTCAAAGATGAGG + Intronic
1106688858 13:32091811-32091833 GCTATCTTTTAGAAAAAATGAGG - Intronic
1106888723 13:34219112-34219134 GAGGCCTTTAAGAAATGATTAGG - Intergenic
1107693403 13:42975543-42975565 GATGCCTTTAAGAAAATGAGAGG + Intronic
1108679763 13:52769528-52769550 GCTTCTTTAAAGAAAAGTTGGGG - Intergenic
1109285607 13:60404992-60405014 GCTGCCATTCACATAAGATGTGG + Intronic
1110177700 13:72577228-72577250 GCTGCCTTTAAGAAACTGAGGGG + Intergenic
1111499699 13:89101332-89101354 GCTAACTTTAAAAAAATATGGGG - Intergenic
1112151469 13:96769221-96769243 GCTGCCTTTAAGGAAATAGCAGG + Intronic
1113014614 13:105814552-105814574 TGCTCCTTTAAGAAAAGATGGGG - Intergenic
1113197361 13:107824010-107824032 TTTGCCTTTAAGGAATGATGGGG - Intronic
1113629200 13:111869470-111869492 GGTGCCTGCAAGAAGAGATGGGG - Intergenic
1114521243 14:23337875-23337897 CCTCCTTTTAAGAAAAAATGTGG + Intergenic
1114894254 14:26966373-26966395 TTTGCATTTAACAAAAGATGAGG - Intergenic
1117073704 14:52079485-52079507 GGTGCCTTTAAGCAAGGAAGGGG - Intergenic
1117162026 14:52999393-52999415 GGTGCCTTGATGAAAAGATCAGG - Intergenic
1117917016 14:60688374-60688396 TCTGCGTTGCAGAAAAGATGGGG - Intergenic
1118258734 14:64227609-64227631 TCTGCCCTTAAGTAGAGATGCGG + Intronic
1118493188 14:66281712-66281734 GATGGCTTTAAGAAAAGTTGTGG - Intergenic
1119521968 14:75293385-75293407 CCTACCTTTAAGAGTAGATGAGG - Intergenic
1120509894 14:85400411-85400433 TCTGATTTTAAGAAAAGAAGGGG + Intergenic
1120854223 14:89199058-89199080 GCTGCCTTCAAGATCAGAGGCGG - Intronic
1121080938 14:91107887-91107909 GCGGCCTTGGAGCAAAGATGTGG + Intronic
1121561076 14:94876042-94876064 ACTGCCCTTAACAAAGGATGGGG - Intergenic
1122739400 14:103862807-103862829 TCTGCCATGAAGAAAAGGTGTGG + Intergenic
1122988241 14:105222933-105222955 CCTGTCTTTAAGAAATGATCAGG - Intronic
1124035231 15:26048491-26048513 GCTTCCTTTTTGAAAAGATTTGG + Intergenic
1126780055 15:52132049-52132071 GCTGCCCTCGATAAAAGATGTGG + Intronic
1128899046 15:71402557-71402579 GCTTCCTGTAAGACAAGCTGAGG - Intronic
1128956309 15:71949572-71949594 GCTGCTTTTTAGAAAAACTGAGG - Intronic
1130223694 15:82043153-82043175 GCTGCCTTTAAGAAAAGATGCGG + Exonic
1131052127 15:89355498-89355520 GCTGCCTTTAAGCAATGCAGTGG - Intergenic
1131854659 15:96580702-96580724 TCTGCCTTTATGAAACCATGTGG - Intergenic
1132267682 15:100489621-100489643 GCTGTGTTTAAAAAAAGATAGGG - Intronic
1134485580 16:14655843-14655865 GCTGGCTTAAAGAGCAGATGCGG - Intronic
1136185808 16:28588283-28588305 TCAGCCTTTCAGAAAGGATGAGG + Intronic
1136750765 16:32633757-32633779 GCTGCTTTTAAGAAAATAAAAGG + Intergenic
1140545534 16:75805236-75805258 GTTTCCTTTAAGGAAAGATATGG + Intergenic
1141742059 16:85900058-85900080 GCTTCCTCTATGAAAAGATTTGG + Intronic
1203052899 16_KI270728v1_random:893017-893039 GCTGCTTTTAAGAAAATAAAAGG + Intergenic
1144805516 17:17964049-17964071 GCTGCCTGTAGGAAGAGGTGAGG + Intronic
1146667708 17:34715952-34715974 CTTGCCTTTAAGAAAGGCTGGGG - Intergenic
1148289687 17:46433703-46433725 GATGCCTTAGAGAAAAGGTGAGG + Intergenic
1148311855 17:46651275-46651297 GATGCCTTAGAGAAAAGGTGAGG + Intronic
1149267838 17:54946973-54946995 TCATCCTTTAAGAAACGATGGGG + Intronic
1149886451 17:60344628-60344650 GCTGTTTTTAAGTAGAGATGAGG + Intronic
1151133586 17:71924011-71924033 GCTGTCTTTTAGAAAAGGAGGGG + Intergenic
1151980967 17:77508203-77508225 GCTGCCTTCCAGAGAAGGTGGGG - Intergenic
1153720037 18:7892325-7892347 GCTGCATTAAAGGAATGATGCGG + Intronic
1153800665 18:8665563-8665585 TCTGCCTTGCAGAAAAGGTGGGG + Intergenic
1153939174 18:9962419-9962441 GCTGCCTTTAGGGAAAAAAGGGG + Intergenic
1155165313 18:23227403-23227425 GCTGCCTTTAGACAAAGATTTGG + Intronic
1156014429 18:32532187-32532209 GGGGCCTTTAAGAAGAGATTAGG + Intergenic
1159590052 18:70324422-70324444 GCTGACATTAAGAAAAGACTGGG + Intronic
1164044966 19:21529894-21529916 CCTGCTTTTAAGAAAAGTTTGGG + Intronic
1164811064 19:31156355-31156377 ACTGCCTTTAGGAAAAGACAAGG - Intergenic
1165091021 19:33388497-33388519 GCTGCCTGGAAGGAAAGCTGTGG - Intronic
925429236 2:3776626-3776648 GCTGGCTTTCAGCAAGGATGAGG + Intronic
925507128 2:4579684-4579706 GGTGCCTTTAAGAGATGATTAGG - Intergenic
927356445 2:22178706-22178728 CCTGTCTTGAAGAAAGGATGAGG - Intergenic
927509187 2:23633940-23633962 GCCACCATTAAGAAAAGGTGGGG - Intronic
928489221 2:31764167-31764189 GATGCCTTCAGGAACAGATGGGG + Intergenic
928972260 2:37042585-37042607 GCTCATTTTAAGAAGAGATGAGG + Intronic
931402416 2:61943368-61943390 CCTCCTTTTAAGAAAAAATGTGG - Intronic
933056904 2:77681845-77681867 GTTGGTTTTAAGAAAAGATTTGG - Intergenic
933617141 2:84494102-84494124 GCTGTCTTTGTGAAAGGATGTGG + Intergenic
933974248 2:87495451-87495473 GCTGCTTTCAAGAGAAAATGTGG + Intergenic
936636006 2:114259138-114259160 GCTGCATTTAAGAAAACAAAAGG + Intergenic
937100774 2:119266274-119266296 TCTGCCTTTAAGAGAACACGGGG - Intergenic
939051805 2:137316473-137316495 ACTGCTGTTAAGAAAAGGTGAGG + Intronic
940679289 2:156763805-156763827 CCTGCATTAAAGAAGAGATGGGG + Intergenic
940778126 2:157905723-157905745 GGGGCCCTTAAGAAAAGGTGCGG - Intronic
941113643 2:161446386-161446408 GCTGGCATTAAGAAAACAAGAGG + Intronic
941991578 2:171562252-171562274 CATTCCTTTAAGAAGAGATGTGG - Intergenic
942887733 2:180948413-180948435 GCTGCCTGGAAGCCAAGATGTGG + Intergenic
944104165 2:196061474-196061496 ACTGAGTTTAAGAAAATATGGGG - Intronic
945261757 2:207850180-207850202 GGTGCCTTTAAGAGGTGATGAGG - Intronic
946966142 2:225040424-225040446 GCTGTCTTTAAAAAGAGGTGGGG - Intronic
948791356 2:240378792-240378814 TCTGGCATTAAGAAAAGGTGAGG + Intergenic
1170324218 20:15137857-15137879 CCTGCCTTTGGAAAAAGATGGGG + Intronic
1170825794 20:19794074-19794096 ACTTCCTTTAAGAGAAGATCAGG + Intergenic
1172449324 20:35010581-35010603 GGTGCCTTTGAGAAAACAAGTGG - Intronic
1174217986 20:48931935-48931957 GCTGCTGTTGAGAAAAGCTGTGG + Intronic
1174962160 20:55170795-55170817 TCTGGCTTAAAGAAAAAATGTGG - Intergenic
1175451609 20:59073504-59073526 GCTACCTTTAAGAAAAAACAGGG + Intergenic
1178134682 21:29614099-29614121 GCTCCATTTAGGAAACGATGGGG - Intronic
1178293692 21:31390971-31390993 TCTGCCTTTAAGAAGAGGCGTGG - Intronic
1180627908 22:17206957-17206979 TCTGGCTTTAATAAAACATGAGG - Intronic
1181710185 22:24679651-24679673 GAAGGCTTTGAGAAAAGATGGGG + Intergenic
1182241501 22:28919887-28919909 GCTGTTTTTAAGGAAAGAGGTGG + Intronic
1184310727 22:43640561-43640583 GCTACCTGAAAGTAAAGATGGGG - Intronic
1185133531 22:49055417-49055439 GGTGGCTTTCAGAAAAGATGTGG + Intergenic
949306690 3:2649826-2649848 GATGCCATTAAGAAAATTTGTGG + Intronic
950554480 3:13686863-13686885 GCTGTCTTTTAGAAATGATTTGG + Intergenic
952060793 3:29507183-29507205 GCTGTATTTAAAAAAAAATGAGG + Intronic
953976708 3:47387045-47387067 GGGGCCATTCAGAAAAGATGTGG + Intronic
957363452 3:79189457-79189479 GCTGCTCCTAAGAAAAGGTGAGG + Intronic
958685643 3:97389024-97389046 CTTGTCTTTAAGAAAAGATTTGG + Intronic
959003636 3:100994127-100994149 TTTGCCATTAAGAAAAGCTGAGG + Intergenic
959014642 3:101120278-101120300 CCAGCCTTTTAGAAAAGATAAGG + Intergenic
962320052 3:134382670-134382692 GGTGCCTTAAACAAAATATGTGG - Intergenic
962947656 3:140186570-140186592 GCTGCCTGTAATCACAGATGAGG + Intronic
963368074 3:144363955-144363977 GTTTCCTTTCAGAAAAGAGGAGG + Intergenic
965011328 3:163095917-163095939 TATGCCTTAATGAAAAGATGGGG + Intergenic
966077392 3:175954127-175954149 TCTGCCTTTAAGGGAAGATAAGG + Intergenic
966196333 3:177317630-177317652 GGCGCCTTTAAGAAATGATTAGG - Intergenic
966257370 3:177932305-177932327 TCTGCCTTTAAGAAAACTTTGGG + Intergenic
967444694 3:189553028-189553050 GGGGCCTTTAAGAAGAGATTAGG - Intergenic
967498814 3:190173962-190173984 GCTGAATTTAATAAAACATGGGG - Intergenic
970188323 4:13484995-13485017 GCTGCCTTAGGGTAAAGATGGGG - Intergenic
971160477 4:24128740-24128762 GCTGCTTTTAAGAGAAGATGGGG - Intergenic
972068487 4:34983190-34983212 GCTGGCTTTAAAGAAATATGAGG + Intergenic
975373151 4:73611272-73611294 GCTGCGTACAAGAAAAGCTGTGG + Intronic
977561681 4:98539350-98539372 GCTGCCTCTGAGAAAAGATAAGG - Intronic
978368065 4:108003381-108003403 GCGGCCTTTAAGAGGAGATTAGG - Intronic
980121481 4:128732419-128732441 GTTACCTTTAAGAGAAGTTGGGG + Intergenic
981339884 4:143609322-143609344 TCTGGCTATAAGAAAAGGTGTGG + Intronic
982967414 4:161930211-161930233 GCTGAATTTAAGAAGACATGTGG + Intronic
984103504 4:175515833-175515855 GGGGCCTTCAAGAAATGATGAGG + Intergenic
984524430 4:180840976-180840998 GATGCCTTTAATTAAAGCTGTGG - Intergenic
985673030 5:1216109-1216131 GGTGCCTTTAGGAAATGGTGAGG + Intronic
986473778 5:8103376-8103398 GCTGACTTAAAGAAAAGGTTTGG + Intergenic
989111167 5:37907761-37907783 GCTGCCCTTGAGAAAATGTGGGG - Intergenic
990418052 5:55605654-55605676 GATGCCTTTAAGAATATTTGTGG + Intergenic
990502622 5:56411574-56411596 ATTGCCTTGAAGCAAAGATGTGG - Intergenic
990590682 5:57260312-57260334 ACTCATTTTAAGAAAAGATGAGG - Intronic
991141034 5:63243503-63243525 GCTTCCTGTGGGAAAAGATGAGG - Intergenic
992242164 5:74783351-74783373 ACTGCTCTTAAGGAAAGATGGGG + Intronic
993267895 5:85751062-85751084 GCTGCCCATAATAAAATATGAGG - Intergenic
993274302 5:85836465-85836487 GCTTCCTTTAATAAAAGTTAGGG - Intergenic
993278285 5:85890813-85890835 GTTGCCTTTAAGAAAACATTAGG - Intergenic
997146951 5:131445193-131445215 TCTGCATATAAGAAAAGATTTGG - Intronic
998957276 5:147451525-147451547 GCCACCTTTAAGGAAAGATAAGG - Intronic
999821995 5:155237607-155237629 CTTGCCTTTAACAAAAGAGGAGG - Intergenic
1000037019 5:157456622-157456644 GCCCCCTTTTAGAACAGATGGGG + Intronic
1001559777 5:172661430-172661452 GCTGCCTTGAAGAAGGGGTGGGG + Intronic
1002002025 5:176201455-176201477 GCTGCTTTTAAGAAAATAAAAGG + Intergenic
1002252214 5:177936951-177936973 GCTGCTTTTAAGAAAATAAAAGG - Intergenic
1002877401 6:1223585-1223607 GCAGCATTTAGGAAAAGAAGTGG + Intergenic
1003178290 6:3770358-3770380 TTTTCCTTAAAGAAAAGATGTGG - Intergenic
1003872125 6:10411948-10411970 GCCGCCGCTAAGAAAAGAGGGGG - Intronic
1004965677 6:20848207-20848229 TCTGCCCTGCAGAAAAGATGGGG + Intronic
1006021798 6:31121687-31121709 GCTGCCTTTGTGAGGAGATGAGG - Intronic
1006243446 6:32707700-32707722 GCAGCCATTAAGGAATGATGTGG - Intergenic
1007011005 6:38417247-38417269 GCTGCCTTTACAAATAGAAGAGG - Intronic
1008151975 6:47964319-47964341 ACTTCCTTTAAAAAAAAATGTGG - Intronic
1009565739 6:65309375-65309397 GCTGCCTTAAAGAAAAAAATTGG + Intronic
1009663424 6:66645548-66645570 GCTGTCTTTCAGAAATGAAGGGG - Intergenic
1011163122 6:84414938-84414960 GTTTCCTTTAAGAAAAAATAAGG + Intergenic
1011650205 6:89499168-89499190 GCAGCCTTTTTGAAAACATGAGG + Intronic
1012663389 6:101933626-101933648 GCTGCAATAAAGAAAAGCTGTGG - Intronic
1013228209 6:108136496-108136518 GCTGCCATAAAAAATAGATGAGG + Intronic
1013403886 6:109825041-109825063 GCTGCATTAAAGAAAATATAAGG - Intronic
1015814128 6:137190853-137190875 CCTCCTTTTAAGAAAATATGTGG - Intergenic
1016842225 6:148536048-148536070 GCTGCCTTTAGGGATAGATTTGG + Intronic
1017442970 6:154481563-154481585 GATGCCTTCAAGAGTAGATGAGG + Intronic
1017682039 6:156873955-156873977 GGTTCCATTAAGAGAAGATGTGG - Intronic
1018325761 6:162666170-162666192 GATGTCTATAAGAAAAGAGGAGG + Intronic
1020665857 7:11042666-11042688 GCTGCCTTTATTAAAAGTTGTGG + Exonic
1021823441 7:24521009-24521031 TCTGTATTTAAGAAAAGATATGG + Intergenic
1022157312 7:27673491-27673513 TCTGGCTTTAAGGAAAGATGTGG - Intergenic
1023480391 7:40627671-40627693 TCTGCCTTGCAGAAAAGGTGGGG + Intronic
1024887956 7:54166628-54166650 CCTCCTTTTAAGAAAAAATGTGG - Intergenic
1030853692 7:114523554-114523576 CCTTCCTTTCAGAAATGATGAGG - Intronic
1032296483 7:130643594-130643616 GCTGCCTTAAAGAAAAAAGAAGG + Intronic
1034330920 7:150281616-150281638 GCTGCCTTTAGGAAAGACTGTGG - Intronic
1034667123 7:152828237-152828259 GCTGCCTTTAGGAAAGACTGTGG + Intronic
1034826914 7:154273978-154274000 CCTGGCTTTATGAAAAGGTGTGG - Intronic
1034901082 7:154908193-154908215 GCTGGCTTCAAGAAAAGCCGTGG + Intergenic
1035979151 8:4349866-4349888 GTTACCTTTAAGAAAAGACAGGG + Intronic
1040096222 8:43445739-43445761 GCTGGGTTTAAGAAAAGACATGG - Intergenic
1040870441 8:52095445-52095467 TTTGCCTTTAATAAAAGATAAGG - Intergenic
1041128197 8:54666843-54666865 ACTGCCTCTGAGAACAGATGGGG - Intergenic
1041335502 8:56777916-56777938 GCTGACTTTGAGCAAAGATTAGG - Intergenic
1041557563 8:59174678-59174700 ACTGCCATTAAGACAACATGAGG - Intergenic
1042969416 8:74391645-74391667 TCTGTCAGTAAGAAAAGATGTGG - Intronic
1043111829 8:76194828-76194850 GATGCATTTAAAAAAAAATGAGG + Intergenic
1043410547 8:79989628-79989650 CCTGCCTTGAAGAAATGTTGCGG - Intronic
1043571804 8:81612288-81612310 GGGGCCTTTAAGAGAAGATTGGG + Intergenic
1043693286 8:83184742-83184764 TCTTCCTTCAAGAAAAAATGGGG + Intergenic
1043768824 8:84171400-84171422 GCTGCCTTTCTGAAGAGATGAGG + Intergenic
1043926412 8:86041945-86041967 GCAGCTTTGAAGAAAATATGTGG - Intronic
1044770701 8:95628519-95628541 GCTGACTTCAAGGAAAGCTGTGG + Intergenic
1044931108 8:97252508-97252530 GCTGCCTCTAAAAGATGATGTGG + Intergenic
1045873235 8:106949465-106949487 GTAGCCTTAAAGCAAAGATGAGG - Intergenic
1047214858 8:122868136-122868158 GCTGTGTTGAAGGAAAGATGTGG - Intronic
1047876527 8:129144178-129144200 GCTGCCTTTAAGAATACTTTGGG - Intergenic
1048721038 8:137325438-137325460 GTTACCTTTAAGAAAAGATAGGG - Intergenic
1049620377 8:143595680-143595702 GTGGCATTTAAGAAAAGACGTGG - Intronic
1049733050 8:144188879-144188901 GCTGCCTTTTAAAGCAGATGTGG + Intronic
1050763365 9:9101780-9101802 TTTTACTTTAAGAAAAGATGTGG + Intronic
1051865985 9:21683247-21683269 GCTGCTTTAAAGGAAAGGTGGGG + Intergenic
1053654083 9:40197730-40197752 GCAGACTTTGTGAAAAGATGGGG + Intergenic
1053904470 9:42826906-42826928 GCAGACTTTGTGAAAAGATGGGG + Intergenic
1054366198 9:64343946-64343968 GCAGACTTTGTGAAAAGATGGGG + Intergenic
1054673828 9:67833676-67833698 GCAGACTTTGTGAAAAGATGGGG + Intergenic
1055526430 9:77138352-77138374 GGTGCCTTTAAGAAGTGATTGGG - Intergenic
1055707901 9:79027469-79027491 GCAGCCTTTAAGGAAAGAATAGG + Intergenic
1056105639 9:83343716-83343738 TCTGCCCCTAAGAAATGATGAGG - Intronic
1056437931 9:86590964-86590986 GCTGCCTTTGAGAAATGTTTGGG + Intergenic
1057379631 9:94555963-94555985 GCAGACTTTGTGAAAAGATGGGG + Intergenic
1057467639 9:95330242-95330264 ACTCCTTTTAAGAAAAGAAGTGG - Intergenic
1057564699 9:96157346-96157368 GCTGCATTTATGAACAGATAGGG - Intergenic
1059999107 9:119942330-119942352 GCTGCCTTTGATAAAACAAGTGG + Intergenic
1062456802 9:136643876-136643898 GATGCCTTCAAGAAAAGAAATGG - Intergenic
1062600714 9:137317561-137317583 GCAGCCTTCCAGAAAAGCTGTGG - Intronic
1186348619 X:8720293-8720315 GCTGCCTGCAACAAAAGTTGCGG - Intronic
1187568502 X:20476578-20476600 GCTAGCTTTAAGATGAGATGTGG - Intergenic
1188962180 X:36506032-36506054 GCTGATTATAAGAAAAGACGTGG - Intergenic
1189081765 X:37980689-37980711 GCTACCTTTAAGAGAAGTTCAGG + Intronic
1189091004 X:38082722-38082744 GCAGCTTTTAAGAAATGAGGAGG + Intronic
1189154999 X:38748128-38748150 TCTGCCTTCAAGAAAGGAGGAGG - Intergenic
1190043966 X:47097416-47097438 GGTGCCTTTAAGATATGATTAGG - Intergenic
1193284335 X:79694205-79694227 GCTGCTTTTTTGAAAAGATCAGG - Intergenic
1193749632 X:85326447-85326469 GCTGCCTGTGTGAAAATATGTGG - Intronic
1193864613 X:86715791-86715813 TCTACCTTTAAGAAGAGAGGAGG + Intronic
1194483542 X:94457289-94457311 GCTTCAGTTAAGATAAGATGGGG + Intergenic
1195175234 X:102308373-102308395 GCTTCCTTTAAGAGAAGAGCAGG - Intronic
1195183631 X:102378720-102378742 GCTTCCTTTAAGAGAAGAGCAGG + Intronic
1196405730 X:115360667-115360689 GCTGCTTGGAAGAGAAGATGAGG - Intergenic
1196412859 X:115438382-115438404 GGTGCCTTTAAGAGATGATTAGG + Intergenic
1196598244 X:117570003-117570025 GCTCACTTTAGGGAAAGATGGGG - Intergenic
1197014650 X:121608810-121608832 GGTGCCTTTAAGAACTGATTAGG - Intergenic
1197113900 X:122808759-122808781 GCTGCTTTTAAAAAGAAATGGGG + Intergenic
1199163204 X:144639012-144639034 CCTGCTTTGAAGAGAAGATGAGG + Intergenic