ID: 1130223696

View in Genome Browser
Species Human (GRCh38)
Location 15:82043157-82043179
Sequence CCTTTAAGAAAAGATGCGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130223690_1130223696 9 Left 1130223690 15:82043125-82043147 CCCAGCACGGTGCGCACTAGCAG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223686_1130223696 16 Left 1130223686 15:82043118-82043140 CCCTTCCCCCAGCACGGTGCGCA 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223691_1130223696 8 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223688_1130223696 11 Left 1130223688 15:82043123-82043145 CCCCCAGCACGGTGCGCACTAGC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223687_1130223696 15 Left 1130223687 15:82043119-82043141 CCTTCCCCCAGCACGGTGCGCAC 0: 1
1: 1
2: 0
3: 14
4: 184
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223689_1130223696 10 Left 1130223689 15:82043124-82043146 CCCCAGCACGGTGCGCACTAGCA 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223684_1130223696 18 Left 1130223684 15:82043116-82043138 CCCCCTTCCCCCAGCACGGTGCG 0: 1
1: 0
2: 4
3: 13
4: 241
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149
1130223685_1130223696 17 Left 1130223685 15:82043117-82043139 CCCCTTCCCCCAGCACGGTGCGC 0: 1
1: 0
2: 4
3: 15
4: 190
Right 1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130223696 Original CRISPR CCTTTAAGAAAAGATGCGGA TGG Exonic
901155341 1:7133606-7133628 CCTTTGAGAAAAGTTGTGTAAGG + Intronic
903810415 1:26032086-26032108 GCTTCGAGAAAAGATGAGGATGG + Intronic
904234037 1:29102256-29102278 CCTTTAATAAAAGCTTCTGATGG + Intronic
909096874 1:71298236-71298258 CCTTCAAGAAAAGATGGGAAGGG + Intergenic
909602213 1:77472572-77472594 CCTGCAAGAAAAGAAGAGGAGGG + Intronic
914875288 1:151509099-151509121 CCTTGAAGAACAGATGACGAAGG + Intergenic
917726915 1:177837018-177837040 CCTTTGAGAAAAGATGGAGAAGG - Intergenic
917952220 1:180050760-180050782 CATTGAAGAAAATATGCAGATGG + Intronic
918340186 1:183562297-183562319 TCTTTTAAAAAAGATGCTGAAGG + Intronic
919327672 1:196129547-196129569 CCTATAAGAAATGAAGTGGAAGG + Intergenic
920773054 1:208908083-208908105 CCTCTTAGAAAGGATGCAGAAGG - Intergenic
921618850 1:217304310-217304332 CCTTTAAGAAAGGGTGGGGAGGG - Intergenic
922368703 1:224888962-224888984 CCTTTCAGAATAGATGTTGAAGG - Intergenic
922529334 1:226331464-226331486 CCTTTAAAAAAAAATGAGGCTGG - Intergenic
923356355 1:233159875-233159897 CCTTCATGAAATGATGGGGATGG - Intronic
1063705359 10:8425034-8425056 CCCTTCAAAAAAGATGAGGATGG - Intergenic
1064188663 10:13186142-13186164 CCTGTAAGAAAAGGTGGGGCAGG - Exonic
1067243576 10:44517339-44517361 CACTTAAGAACAGATGGGGACGG - Intergenic
1069344058 10:67446560-67446582 GCTATAAGAAAAGATGAGGAGGG - Intronic
1071050868 10:81447775-81447797 ACTATAAGAAGAGATGAGGAAGG - Intergenic
1071125464 10:82329761-82329783 CATATAAGAAAAGATTTGGAAGG - Intronic
1073495579 10:103888131-103888153 CCTTTAAGAAACCATGAGGTCGG - Intronic
1074005777 10:109421695-109421717 CTTATAAGAAAATATGCGGCCGG + Intergenic
1074102948 10:110367989-110368011 CCTTGAAGAAAAGTTGCAGTTGG + Intergenic
1077075187 11:697625-697647 CCTTTAAGAAAAGGAACAGAAGG + Intronic
1077766810 11:5166608-5166630 ACTGTAAGAAAAGATAAGGAGGG - Intronic
1080459570 11:32441417-32441439 CTTTAAAAAAAAGATGGGGAAGG - Intergenic
1081967702 11:47179460-47179482 CCTTGAAGAAAAGAAGCCGCTGG + Exonic
1083609309 11:63997665-63997687 CCTTTAATAAAACATGGGGGGGG - Exonic
1085080894 11:73633368-73633390 CCTGCAGGAAAAGATGCGAAAGG - Intergenic
1085171695 11:74454962-74454984 CCCTCAAGAAGAGATGAGGAAGG + Exonic
1085474738 11:76782856-76782878 TCTTTAAAAAAAAATGGGGAGGG + Intronic
1087006172 11:93474160-93474182 CCTTTACGAAACAATGGGGAAGG + Intergenic
1089410225 11:118235015-118235037 GCTTTAAGAATAGCTGTGGAGGG - Intronic
1090234974 11:125140379-125140401 CCCTGAAGAAAAGAGGCGGAAGG + Intergenic
1090985044 11:131758890-131758912 GCTTTAAGAAAATATGCAGACGG - Intronic
1092314990 12:7401444-7401466 ACTTTAAAAAAAGATGCATATGG + Intronic
1094386997 12:29905688-29905710 ACTTTATGAAAAGAAGGGGAAGG - Intergenic
1095999699 12:48119095-48119117 CCATTAAATAAAGATGCTGATGG + Intronic
1096018062 12:48296473-48296495 CTTTTAAGGAAAGAGACGGAAGG + Intergenic
1099679735 12:85810456-85810478 ACTTTATGAAATGATGCTGAGGG - Intronic
1099967276 12:89462201-89462223 CCATAAAGAAAATATGCTGAGGG + Intronic
1099987647 12:89686165-89686187 CCTTGAAGAACACATGCTGAAGG - Intronic
1100404261 12:94259765-94259787 CCTTTAAGAAAAAATCAGGCCGG + Intronic
1101376423 12:104175244-104175266 CCTTTAAGAGAAATTGAGGAGGG + Intergenic
1104395769 12:128431219-128431241 GCTTAAAGAAAAGTTGTGGATGG - Intronic
1104874242 12:132022028-132022050 CCTTTCTGGAAAGATGCAGATGG + Intronic
1107526147 13:41233693-41233715 CCTTTCTGAAAAGATGCAGACGG - Intronic
1108344707 13:49534113-49534135 CCTTTAAGAACTGAAGCGCAAGG - Exonic
1111054321 13:82927965-82927987 CCTCTAAAATAAGATGCTGATGG - Intergenic
1115688537 14:35821713-35821735 GATTTTAGAAAAGATGCGTAGGG - Intergenic
1116408406 14:44594275-44594297 GCTTTATGAAAAGATGCAAAGGG + Intergenic
1120729556 14:87987260-87987282 CCTTTAAGAAGAAATGGGCAAGG - Intronic
1125967626 15:43887064-43887086 CCCTTAAGAAATGCTGCTGAAGG + Intronic
1130131591 15:81147911-81147933 ACCTTAAGAAAAGATGCCGGTGG - Exonic
1130223696 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG + Exonic
1131287558 15:91074353-91074375 CCTTTAAGAAGTGATGGGGTGGG - Intergenic
1131728100 15:95249479-95249501 CCATTAAGCAAGGATGCGGATGG - Intergenic
1132094258 15:98970341-98970363 CATTTAAAAAAAGATGCAGGAGG - Intronic
1134913782 16:18052155-18052177 CCTTTAAGAAAATGTTCGGCCGG + Intergenic
1137451122 16:48575359-48575381 CTTTTAAGAAAAAAGGGGGAGGG + Intronic
1137962261 16:52894581-52894603 TCTTTTAGAAAAGATGCTAATGG + Intergenic
1138433055 16:56981731-56981753 CCTTAAAGAAAGCAGGCGGAGGG + Intronic
1141686501 16:85573163-85573185 CCTTTAAAAAAAGAAAGGGATGG - Intergenic
1143696412 17:8623275-8623297 CCTCTAAGAGAAGAGGAGGAGGG + Exonic
1146738331 17:35258942-35258964 CCATTTAGATAAGATGCAGAAGG + Exonic
1148010869 17:44480283-44480305 CATTTAAAAAAAAATGCGGCAGG + Intronic
1154468733 18:14676654-14676676 CATTTAAAAAAAGATTAGGAGGG + Intergenic
1155189595 18:23417744-23417766 CTTTTAAGAAAATATGAGTAAGG + Intronic
1156273670 18:35560850-35560872 CCTTTAAGAGAAGATGCTTGGGG - Intergenic
1158329893 18:56350166-56350188 CTTTTAAGAAAAGATGCTGCTGG - Intergenic
1160475948 18:79187979-79188001 CCTTTAAGAAGAGATCTGGCAGG + Intronic
1161712328 19:5855938-5855960 CCTTTAAGAATAGATGTTGGAGG - Intergenic
1162273996 19:9638746-9638768 CCTTTGAGAATAGATGTTGAAGG + Intronic
1162286869 19:9745331-9745353 CCTTTGAGAATAGATGTTGAAGG - Intergenic
1164969593 19:32520222-32520244 GTTATAAGAAAAGATGAGGATGG - Intergenic
1166604985 19:44133598-44133620 CTTTTAAGAAAAGGTGTGTATGG + Exonic
1167787627 19:51648611-51648633 CATTTGAGTAAAGATGCGAAGGG + Intergenic
924990750 2:310775-310797 CCTTCCAGAAAAGCTGCAGAAGG + Intergenic
925899741 2:8500232-8500254 CCTTTAAGAGAAGCTGGGGCTGG + Intergenic
927904931 2:26849037-26849059 CGGTTGAGAAAAGATGGGGATGG + Intronic
928055824 2:28053386-28053408 CCTTTAAGATAAGAAGATGACGG - Intronic
931471936 2:62547158-62547180 ATTTTAAGAAAAGATGAGTAGGG - Intergenic
931773347 2:65518252-65518274 TCTTTAAGAAAGGATCTGGAAGG + Intergenic
939407145 2:141772943-141772965 CTTTTAACAAAAGAGGAGGAAGG - Intronic
945358819 2:208870943-208870965 CCTTTAAGAAAATATGGGCCAGG + Intergenic
945839395 2:214869663-214869685 TCTTTAGGAAAAGATGCCCATGG + Intergenic
1169105889 20:2994170-2994192 TTATTAAGAAAAGATGAGGAGGG + Intronic
1170069861 20:12354695-12354717 CCGCTGAGAAAAAATGCGGAAGG + Intergenic
1174812698 20:53660676-53660698 CCTTTAAGAAAGGATGTGCTGGG - Intergenic
1181104019 22:20561686-20561708 CCTACAATAAAACATGCGGAAGG + Intronic
1184310725 22:43640557-43640579 CCTGAAAGTAAAGATGGGGATGG - Intronic
950223117 3:11211809-11211831 CCTTTAAGCATAGATGCAGAAGG + Intronic
951147751 3:19249559-19249581 CTTTTGACAAAAGATGCTGAAGG - Intronic
954450607 3:50569436-50569458 CCTTTAAGAAAAGGCTCGGGCGG - Exonic
956221848 3:66912944-66912966 CTTTTAAGAAAATATGAGGCTGG + Intergenic
956644081 3:71439357-71439379 CCTTCAAGAAAGGGTGGGGAGGG + Intronic
957609080 3:82444064-82444086 CCTTTGGGAAAAGAAGGGGAAGG - Intergenic
957788258 3:84907931-84907953 CCTTTAAGAAAAAAGTCGGCCGG - Intergenic
959425053 3:106177026-106177048 CCTTTAAAAAACGAAGAGGAAGG - Intergenic
963816483 3:149837152-149837174 ACATTAAGAAAAGAGGCTGAAGG + Intronic
965530184 3:169763955-169763977 CCTTTAAGAAAATAAGCTAATGG - Intergenic
966231641 3:177658882-177658904 CCTTTCAGAAAATCTGAGGAAGG + Intergenic
971182397 4:24341559-24341581 ACTTTAAGAAAAGATAATGACGG + Intergenic
971202379 4:24522535-24522557 CCTTTAATAAGAGAAGGGGAGGG - Intronic
971284127 4:25270645-25270667 CCTTTAACTAAAGGTGAGGAGGG - Intronic
972254621 4:37339995-37340017 CCTATAATAAAATATGAGGACGG - Intronic
975363968 4:73506348-73506370 CCTTTAAGATAAAATATGGAAGG - Intergenic
979891182 4:126097267-126097289 CATTTAAGAAAAGATTCCCAGGG - Intergenic
980722302 4:136714965-136714987 CCTCTAAGAAAAGACTTGGATGG - Intergenic
984103506 4:175515837-175515859 CCTTCAAGAAATGATGAGGCCGG + Intergenic
985331910 4:188846498-188846520 TCTGTAAGAAAGGATGAGGAAGG - Intergenic
985340621 4:188948784-188948806 TATTTAAGAAAAGATGAGGCCGG - Intergenic
988968906 5:36446268-36446290 CACTTAAGAAAAGAAGCAGATGG - Intergenic
989106749 5:37869974-37869996 CCTTAAAGAATAGATGCTGAAGG + Intergenic
989591841 5:43120030-43120052 CCTGTAAGAAGAGATGTGGGCGG - Intronic
990166224 5:52996172-52996194 CCTTTAAGCAAACATGGGAAAGG + Intronic
991511091 5:67376879-67376901 CCTTCAAGGAAAGAGGCTGATGG - Intergenic
992777462 5:80101124-80101146 CATTTAGGAAAAAATGTGGAAGG + Intergenic
994104239 5:95928620-95928642 CATTTAAGAAATGTTTCGGAAGG - Intronic
996268896 5:121578665-121578687 CCTTTAAGAAAACAGGCCGGGGG - Intergenic
996470876 5:123859299-123859321 CGTTTTAGAAAAGATGTGTAGGG - Intergenic
997247839 5:132365954-132365976 CCTTTAAGAAAAGAATAGGCTGG - Intergenic
999496660 5:152105768-152105790 ACTTTGAGAAATGATGCAGAAGG - Intergenic
1001536280 5:172500275-172500297 CCTTTAAGATAAAATGTAGAGGG + Intergenic
1001765728 5:174245100-174245122 CACTTAAGTAAAGATGCAGATGG - Intergenic
1004261216 6:14109347-14109369 CCTTTAAGAAAAAGTCCCGAGGG - Intergenic
1006243444 6:32707696-32707718 CCATTAAGGAATGATGTGGATGG - Intergenic
1007930885 6:45689760-45689782 CCTTCAAAAAAAGAAGAGGAAGG - Intergenic
1011163125 6:84414942-84414964 CCTTTAAGAAAAAATAAGGTGGG + Intergenic
1013142662 6:107354317-107354339 TCTTTAAGAAAAGATGGCAAAGG - Intronic
1015831982 6:137380293-137380315 CCTTAAAGAAAACATACAGATGG + Intergenic
1019303771 7:322680-322702 CATTTGAGAAAAGATGGGGTAGG - Intergenic
1020153856 7:5705607-5705629 CCTTTAAAAAAAACTGCGGTAGG + Intronic
1020838658 7:13186349-13186371 ACTTTAAAAAAAGATGAGGCTGG + Intergenic
1021187411 7:17580758-17580780 ACTTCAAAAAAAGATGCTGATGG + Intergenic
1026973989 7:74485315-74485337 CCTTTAAAAATAGATGCAGCTGG + Intronic
1027928237 7:84496081-84496103 CCTTTAAAAAAAGTTGCTGCTGG + Intergenic
1031554657 7:123157963-123157985 GCTTTAAGAAAAAATGCTCATGG - Intronic
1033244305 7:139705326-139705348 CTTTTAAGAGAAGATGAGGTTGG - Intronic
1035788931 8:2286105-2286127 CCTATAAGAAAACATGTGGTGGG - Intergenic
1035803874 8:2435600-2435622 CCTATAAGAAAACATGTGGTGGG + Intergenic
1038338801 8:26666897-26666919 ACTTTGAGAAAAGATGCACAGGG - Intergenic
1043682176 8:83042016-83042038 CCTTTCAGAGAAAATGTGGAAGG + Intergenic
1045881164 8:107042274-107042296 CTTTTAAAAAAAGATGGGGGTGG + Intergenic
1048733332 8:137469128-137469150 CCTTCAAGAAAAACAGCGGAAGG - Intergenic
1048944944 8:139436528-139436550 CCTTTGCGAAAAGTTGCTGATGG + Intergenic
1049620376 8:143595676-143595698 CATTTAAGAAAAGACGTGGTTGG - Intronic
1050869547 9:10549939-10549961 GCTTAAAGGAAAGATGAGGATGG - Intronic
1054878713 9:70123038-70123060 CCTTTAAGAGAACTTGCTGAAGG - Intronic
1055847573 9:80585495-80585517 ACTTTAAGAAAAGAAAAGGAAGG + Intergenic
1058734686 9:107883493-107883515 CCTTTATGAGAAGCTGGGGAGGG + Intergenic
1059221769 9:112628358-112628380 CCTTTAAGCAAAGAGGTGGTGGG - Intronic
1060202906 9:121662121-121662143 ACTTAAAGAAAAGAAGGGGAAGG - Intronic
1186371130 X:8948577-8948599 ACTTTAAGAAAAGAAGCCGTTGG + Intergenic
1188649222 X:32610689-32610711 TCTTTAAGAAAAAATGGTGATGG + Intronic
1190744080 X:53310823-53310845 CATTTAAGAAAAGATGCACTGGG + Intronic
1193864615 X:86715795-86715817 CCTTTAAGAAGAGAGGAGGCAGG + Intronic
1194515460 X:94846050-94846072 CCTATAAGAAAAGATAAAGAAGG - Intergenic
1198768671 X:140105241-140105263 CCTTTAAGAAAAAATCCAAATGG - Intergenic
1199006366 X:142702329-142702351 CCTTTGAGAAAAGTGGCAGAGGG + Intergenic