ID: 1130223697

View in Genome Browser
Species Human (GRCh38)
Location 15:82043172-82043194
Sequence GCGGATGGCCTGAGTGACCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130223691_1130223697 23 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223689_1130223697 25 Left 1130223689 15:82043124-82043146 CCCCAGCACGGTGCGCACTAGCA 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223695_1130223697 -8 Left 1130223695 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223690_1130223697 24 Left 1130223690 15:82043125-82043147 CCCAGCACGGTGCGCACTAGCAG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223692_1130223697 -1 Left 1130223692 15:82043150-82043172 CCCGCTGCCTTTAAGAAAAGATG 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223688_1130223697 26 Left 1130223688 15:82043123-82043145 CCCCCAGCACGGTGCGCACTAGC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223687_1130223697 30 Left 1130223687 15:82043119-82043141 CCTTCCCCCAGCACGGTGCGCAC 0: 1
1: 1
2: 0
3: 14
4: 184
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1130223693_1130223697 -2 Left 1130223693 15:82043151-82043173 CCGCTGCCTTTAAGAAAAGATGC 0: 1
1: 0
2: 1
3: 30
4: 281
Right 1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130223697 Original CRISPR GCGGATGGCCTGAGTGACCG CGG Exonic
901597723 1:10398781-10398803 GCGGACGGCCTGCAGGACCGAGG + Intronic
901921446 1:12540419-12540441 GGTGATGGATTGAGTGACCGCGG + Intergenic
902609421 1:17588378-17588400 GGGGAAGGCCTGAGTGCCTGGGG + Intronic
903674910 1:25057487-25057509 GCTGATGGCCTCAGTGGCAGAGG - Intergenic
903810206 1:26031083-26031105 GCGAGTGGCCTGTGTGACCATGG - Intronic
909011945 1:70344374-70344396 GAGGATTGCCTGAGTGTCGGAGG + Intronic
915537070 1:156543229-156543251 GCAGATGGCCTGAGTGTGCATGG + Intronic
920595476 1:207264887-207264909 GCTGAAGGCCTGAGAGACCCTGG - Intergenic
922548167 1:226474021-226474043 GCTGAAGGCCTGAGAGACCCTGG + Intergenic
922883051 1:228997083-228997105 GCGGATGTCCTGTGTGACTTTGG + Intergenic
924052367 1:240092059-240092081 CGGGATGGCCTGAGTGCCCGCGG + Exonic
924708972 1:246518945-246518967 AGGGGTGGCCTGGGTGACCGAGG + Intergenic
924934501 1:248756663-248756685 GCTGATGGCCTGAGAGCCCCTGG + Intergenic
1065325121 10:24544018-24544040 GCGAATGGCTTGAGTGAGAGCGG - Exonic
1065883693 10:30059115-30059137 GCGGAGGGCCTGGGGGGCCGGGG - Intronic
1067278584 10:44854872-44854894 GTGGATGCCCTGAGTGACACAGG - Intergenic
1070152644 10:73814434-73814456 CTGGAGGGCCTGAGTGACAGCGG - Exonic
1070745806 10:78933149-78933171 GCCCGTGGCCTGAGTGAACGTGG - Intergenic
1075705335 10:124497183-124497205 GCTGAGGGCCTGAGGGCCCGAGG - Intronic
1076604848 10:131682765-131682787 CCGGATTTCCTGAGTGCCCGGGG - Intergenic
1077316366 11:1921073-1921095 GGGGAGGGCCTGGGTGCCCGAGG + Intronic
1078512099 11:11992488-11992510 GCTGATGGGCTGAGTCACAGAGG - Intronic
1079009087 11:16813634-16813656 GGAGATGGCCTGGGTGACCCAGG + Intronic
1079792004 11:24749805-24749827 GCTGATGGCCTGAGAGCCCCTGG - Intronic
1083776378 11:64896108-64896130 GCGTATGGCCTGAATGAACCAGG + Intronic
1083920873 11:65780941-65780963 CCGGCCGGCCTGAGTGCCCGCGG - Intergenic
1085319493 11:75565233-75565255 GCAGATGGCCTGTGTGGCAGTGG + Intronic
1085535083 11:77212742-77212764 GAGGATGGCCTGGGGGACCCAGG + Intronic
1095957833 12:47816914-47816936 GCGAGTGGCCTGAGTGAGCATGG - Intronic
1096476544 12:51912513-51912535 GCTGATGGCCTTGGTGACCCAGG + Exonic
1097046423 12:56190176-56190198 TCGGATGGACTGGGTGACCCAGG - Intergenic
1100074646 12:90765224-90765246 GCGGAAGGCCTGAGAGCCCCTGG - Intergenic
1104891377 12:132141778-132141800 GCAGGTGGCCTGAGGCACCGTGG - Intronic
1105417668 13:20227402-20227424 GAGACTGTCCTGAGTGACCGGGG - Intronic
1107877650 13:44804852-44804874 GCTGAAGGCCTGAGAGACCCTGG - Intergenic
1108466777 13:50724719-50724741 GCCGATAGCCTGAGTGAGTGAGG - Intronic
1113302441 13:109036940-109036962 GCAGCTGCCCTGAGTGACCCTGG + Intronic
1114542126 14:23468876-23468898 GCTGAAGACCTGTGTGACCGCGG + Intergenic
1116861380 14:49998243-49998265 GCAGATGGCCTGGGGGACAGGGG + Intronic
1118514070 14:66507941-66507963 CCGGATTGGCTGAGTGAACGCGG - Exonic
1121234305 14:92380849-92380871 GCTCATGAGCTGAGTGACCGTGG + Intronic
1121624076 14:95371898-95371920 GCAGATGGCCAGAGTGACCTTGG + Intergenic
1125528098 15:40391577-40391599 GCGCAAGGGCTGAGTGACTGTGG + Intronic
1128421660 15:67497239-67497261 GCGGATGGCCTGAGTCAGGTAGG + Intronic
1129461761 15:75703300-75703322 GGGGATGGACTGAGAGATCGGGG + Intronic
1129723091 15:77888546-77888568 GGGGATGGACTGAGAGATCGGGG - Intergenic
1129871509 15:78944658-78944680 GCAGATGGGCTGAGTGTCCAGGG - Intronic
1129922547 15:79332368-79332390 CCAGATGGCCTGTGTGAGCGAGG - Intronic
1130223697 15:82043172-82043194 GCGGATGGCCTGAGTGACCGCGG + Exonic
1130772561 15:86939417-86939439 GCGGAAGGCCTGAGGGCCCCTGG - Intronic
1136348962 16:29694896-29694918 GCCGGTGGCCAGAGTGGCCGAGG + Exonic
1136477134 16:30520465-30520487 AGGGATGGGCTGAATGACCGTGG - Intronic
1139217807 16:65146248-65146270 GCTGAAGGCCTGAGAGCCCGTGG + Intergenic
1141699508 16:85636014-85636036 GCGGGTGGCCTGAGTGCCAGAGG + Intronic
1144472793 17:15559746-15559768 GCTGATGGACTGACTGACTGGGG + Intronic
1145792596 17:27637387-27637409 GCTCATGACCTGAGTGACCTTGG - Intronic
1150821202 17:68435829-68435851 GCAGATGGCCTGGGGGACAGAGG - Intronic
1154156305 18:11947265-11947287 GCGGCTGGCCTGAGTCTACGCGG - Intergenic
1167607756 19:50490555-50490577 GTGGACAGCCTGAGTGACAGGGG + Exonic
1168294689 19:55372990-55373012 GCTGGTGGCCTGAGTCACCTTGG - Intergenic
927480832 2:23452567-23452589 GCTGATGGCATGAGTGAACCTGG - Intronic
928443790 2:31315218-31315240 GGGGATGGACTGAGTGGCCTGGG + Intergenic
932975482 2:76595100-76595122 GCTGAAGGCCTGAGTGCCCCTGG - Intergenic
934745513 2:96757077-96757099 GCTGATTGCCTGTGTGACCTGGG - Intergenic
937981978 2:127621082-127621104 GCAGATGGCTTCAGTGACCGTGG - Intronic
947824019 2:233092159-233092181 GCGGGCGGCCGGAGTGACTGGGG + Intronic
948452830 2:238088000-238088022 GAGGATTGCTTGAGTGAGCGTGG + Intronic
948668033 2:239548455-239548477 GCAGATGGCCTGAGAGCCCATGG - Intergenic
1171973907 20:31581685-31581707 GAGGATGGACTGAGAGTCCGAGG - Intergenic
1172757880 20:37299991-37300013 GCTGATGGCGTGAATGACAGGGG - Intronic
1173900722 20:46586769-46586791 GGGGATGGCTTGAGTGAGGGTGG - Intronic
1175844846 20:62052846-62052868 GGGGATGGCCTGAGGGACCTGGG - Intronic
1176240689 20:64074586-64074608 GCTGAGGGCCTGTGTGGCCGTGG - Intronic
1176553729 21:8243486-8243508 TCGGATGCCCCGAGTGACTGTGG + Intergenic
1176572651 21:8426510-8426532 TCGGATGCCCCGAGTGACTGTGG + Intergenic
1176580560 21:8471071-8471093 TCGGATGCCCCGAGTGACTGTGG + Intergenic
1179906251 21:44424728-44424750 GCGCAGGGGCTGAGTGACAGGGG + Intronic
1183607247 22:38872856-38872878 GAGGAAGGCCGGAGTGACCGTGG + Intergenic
1184428098 22:44424904-44424926 GCTGATGGCCACAGTGACCAGGG + Intergenic
1184601532 22:45546683-45546705 GCGTATGGGCTGGGTGGCCGAGG + Intronic
1203258733 22_KI270733v1_random:160518-160540 TCGGATGCCCCGAGTGACTGTGG + Intergenic
950552910 3:13677682-13677704 CCTGATGGACTGAGTGACCCGGG - Intergenic
953699311 3:45183719-45183741 CTTGATGGCCTGAGTGACTGGGG - Intergenic
960529257 3:118744716-118744738 GTGGATGGACTAAGTGACCAGGG - Intergenic
970082053 4:12298780-12298802 GCTGAAGGCCTGAGTGCCCCTGG + Intergenic
982788367 4:159561673-159561695 GCTGAAGGCCTGAGAAACCGAGG + Intergenic
983428595 4:167619581-167619603 CCAGATGGCCAGAGTGACCATGG + Intergenic
998172864 5:139882686-139882708 GGGGATCGCCTGAGGGTCCGGGG + Intronic
999727597 5:154449331-154449353 GCAGAAGGCCTGGGTGACCTTGG + Intronic
1002565864 5:180112869-180112891 GAGGATGGACGGAGGGACCGGGG + Intronic
1002565870 5:180112888-180112910 GGGGATGGACGGAGGGACCGTGG + Intronic
1002565892 5:180112945-180112967 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565900 5:180112964-180112986 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565923 5:180113021-180113043 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565952 5:180113097-180113119 GGGGATGGACGGAGGGACCGGGG + Intronic
1002565997 5:180113230-180113252 GGGGATGGACGGAGGGACCGAGG + Intronic
1002566003 5:180113249-180113271 GAGGATGGACGGAGGGACCGAGG + Intronic
1002566025 5:180113306-180113328 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566033 5:180113325-180113347 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566055 5:180113382-180113404 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566083 5:180113458-180113480 GGGGATGGACGGAGTGACCGGGG + Intronic
1002566091 5:180113477-180113499 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566106 5:180113515-180113537 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566149 5:180113630-180113652 GGGGATGGACGGAGTGACCGGGG + Intronic
1002566157 5:180113649-180113671 GGGGATGGACGGAGGGACCGGGG + Intronic
1002566194 5:180113744-180113766 GGGGATGGACGGAGGGACCGGGG + Intronic
1006392865 6:33769073-33769095 GAGGATTGCTTGAGTGACGGAGG + Intergenic
1007619691 6:43204362-43204384 GCGGAAGGCGTGAGTGCCCTGGG + Exonic
1022488074 7:30795525-30795547 CCTGATGGCCTGTGTGACCCTGG - Intronic
1023965536 7:44961626-44961648 GCTGAGGGCCTGAGGGACTGAGG + Intergenic
1024753378 7:52497204-52497226 GAGGATGGCTTGAGTGTCAGAGG - Intergenic
1034251256 7:149692672-149692694 GAGGAAGGACTTAGTGACCGAGG - Intergenic
1042693118 8:71525926-71525948 GCGAAAGGACTGAGTGACAGAGG + Intronic
1045393728 8:101739710-101739732 GCTGAAGGCCTGAGAGACCCTGG - Intronic
1047521623 8:125599443-125599465 GAGCATGGCCTGAGTCACAGTGG - Intergenic
1049263452 8:141652370-141652392 GAGGTGGGCCTCAGTGACCGCGG + Intergenic
1053279553 9:36809491-36809513 GGGGACAGGCTGAGTGACCGGGG + Intergenic
1054967631 9:71047576-71047598 GAGGATAGCCTGAGTTACAGGGG - Intronic
1058716053 9:107722873-107722895 GGTGATGGCGTGAGTGACGGGGG + Intergenic
1059769610 9:117413950-117413972 CCGCATGGGCTGAGTGACCTTGG - Intronic
1060333365 9:122697317-122697339 GCGGATGGCTTGAGTGTGGGGGG - Intergenic
1062120903 9:134833633-134833655 GCAGATGGCTGGGGTGACCGGGG - Intronic
1203474923 Un_GL000220v1:142529-142551 TCGGATGCCCCGAGTGACTGTGG + Intergenic
1187746205 X:22411905-22411927 GCCAATGGCCTGAGTGAGCTTGG + Intergenic
1189466252 X:41279904-41279926 GCAGATGTCCTGACTGACCATGG + Intergenic