ID: 1130223698

View in Genome Browser
Species Human (GRCh38)
Location 15:82043177-82043199
Sequence TGGCCTGAGTGACCGCGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130223692_1130223698 4 Left 1130223692 15:82043150-82043172 CCCGCTGCCTTTAAGAAAAGATG 0: 1
1: 0
2: 2
3: 24
4: 348
Right 1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 78
1130223693_1130223698 3 Left 1130223693 15:82043151-82043173 CCGCTGCCTTTAAGAAAAGATGC 0: 1
1: 0
2: 1
3: 30
4: 281
Right 1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 78
1130223695_1130223698 -3 Left 1130223695 15:82043157-82043179 CCTTTAAGAAAAGATGCGGATGG 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 78
1130223691_1130223698 28 Left 1130223691 15:82043126-82043148 CCAGCACGGTGCGCACTAGCAGC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 78
1130223690_1130223698 29 Left 1130223690 15:82043125-82043147 CCCAGCACGGTGCGCACTAGCAG 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 78
1130223689_1130223698 30 Left 1130223689 15:82043124-82043146 CCCCAGCACGGTGCGCACTAGCA 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130223698 Original CRISPR TGGCCTGAGTGACCGCGGTG TGG Exonic
900120854 1:1048125-1048147 TGGCTTGTGTGACTGGGGTGCGG - Exonic
901272985 1:7967889-7967911 TAGCCTGGGTGACAGAGGTGAGG + Intronic
901336640 1:8454927-8454949 TGGCCTGAGAGTCAGAGGTGTGG - Intronic
901790235 1:11650092-11650114 GGGACTGAGTGACCAGGGTGGGG - Intronic
901836260 1:11925994-11926016 CGGCCTGCGGGAGCGCGGTGAGG - Exonic
903935293 1:26890999-26891021 TTGCCTGACTGACCGGGTTGGGG - Exonic
905668518 1:39776453-39776475 TGGGCTCAGTGACCACGGTCAGG + Intronic
905962004 1:42050797-42050819 TGGCCTGAGTGGCCGAGCTGGGG - Intergenic
924052368 1:240092064-240092086 TGGCCTGAGTGCCCGCGGCGCGG + Exonic
1076729690 10:132432145-132432167 AGGCCTGGGTGAGGGCGGTGTGG + Intergenic
1077722942 11:4645791-4645813 TGACTTGAGTGACCAGGGTGGGG + Intronic
1084012875 11:66362452-66362474 TGGCCTCAGTGAACTGGGTGGGG - Intronic
1089632338 11:119791642-119791664 TGGACTGAGTGAGCGTTGTGTGG + Intergenic
1090004062 11:122984590-122984612 TGCCCTGAGGAACCGCGGCGGGG + Intergenic
1090803863 11:130190467-130190489 TGGCCTGCACGCCCGCGGTGTGG + Exonic
1091049139 11:132352068-132352090 TGGCCTCAGTCACAGCTGTGGGG + Intergenic
1091571607 12:1691382-1691404 TGGCCTGAGGGTCGGCCGTGTGG + Intronic
1095878260 12:47105225-47105247 TTGACAGAGTGAACGCGGTGGGG + Intronic
1099817613 12:87668981-87669003 GGGCCTGAGTGACTGCCCTGGGG + Intergenic
1106250828 13:27980454-27980476 GGGCCTGGGTGAGCGCGGAGGGG - Intronic
1110779809 13:79451737-79451759 TGCCCTGAGTCACCGCCCTGTGG - Intergenic
1114633088 14:24172106-24172128 TGGCTTGGGCGGCCGCGGTGTGG - Exonic
1116945520 14:50831458-50831480 CGGCCCGAGTGTCCGCGGTGCGG - Intergenic
1120206462 14:81591955-81591977 TTGCCTGAGTGAGTCCGGTGTGG + Intergenic
1124370046 15:29099381-29099403 TGTCCTGTGTGACTGCGGGGAGG - Intronic
1124554426 15:30711556-30711578 TGACCTTAGTGACCCCGGAGTGG - Intronic
1129753616 15:78082910-78082932 TGGCCTGAGACACAGCTGTGAGG + Intronic
1130223698 15:82043177-82043199 TGGCCTGAGTGACCGCGGTGTGG + Exonic
1135250755 16:20899885-20899907 TGTCCTGGGTGAGCGCTGTGAGG - Intronic
1136348964 16:29694901-29694923 TGGCCAGAGTGGCCGAGGTCCGG + Exonic
1138385807 16:56635190-56635212 GGGTCCGAGGGACCGCGGTGTGG + Intergenic
1138660672 16:58515399-58515421 TGGCCGGAGTTACCGCGGGCTGG - Intergenic
1139390946 16:66605823-66605845 TGCCCTGAGTGACCAGGGAGAGG - Intronic
1140235188 16:73152781-73152803 TGGCCTGGGCTACCGGGGTGAGG + Intergenic
1142986371 17:3697388-3697410 GGCCCTGGGTGAGCGCGGTGTGG + Intergenic
1145280656 17:21464668-21464690 GGGTCTTAGTGAGCGCGGTGCGG - Intergenic
1145397241 17:22505846-22505868 GGGTCTTAGTGAGCGCGGTGCGG + Intergenic
1152995524 18:402807-402829 TGGCCTGAGTTACCACTTTGGGG + Intronic
1159064048 18:63549827-63549849 TGTCCTGAGTGACCACCATGTGG - Intergenic
1159952621 18:74496312-74496334 TGGCCAGGGCGACCGCGGGGCGG + Exonic
1160681664 19:414217-414239 TGGCCAGTGTGGCCGAGGTGAGG - Intergenic
1160762380 19:791992-792014 TGGCCTGAGGGCCCAGGGTGGGG + Intergenic
1160817906 19:1044728-1044750 TGGGCCGAGTGACGGAGGTGAGG + Exonic
1160927831 19:1555580-1555602 TGGCCTGGGTGGCCGGCGTGCGG + Exonic
1168237991 19:55075762-55075784 TGGCTGGAGTGACCCCGGGGCGG - Intronic
926111906 2:10189005-10189027 TGGCCTGAGTGATTGATGTGTGG - Intronic
928433855 2:31241090-31241112 TGGCCTCAGTGACTGGGGTGTGG - Intronic
929885283 2:45872580-45872602 TGGCCTGAATCAGCGTGGTGGGG + Intronic
938585584 2:132687177-132687199 AGGCCTGAGTGACTTCAGTGGGG + Intronic
944790821 2:203123812-203123834 TGGCCTGAGTTACAGCTATGTGG + Intronic
946482138 2:220067481-220067503 TGGGGTGAGTGACAGAGGTGGGG + Intergenic
948388172 2:237594583-237594605 TGGCCTGAGTGCCCGCCCAGGGG + Intronic
1172166519 20:32903027-32903049 TGGCCTGAGGGGACACGGTGAGG - Intronic
1175919787 20:62445440-62445462 TGGCCTGAGAGTCCGCTGTTGGG + Intergenic
1179906254 21:44424733-44424755 GGGGCTGAGTGACAGGGGTGGGG + Intronic
1179922079 21:44512822-44512844 TGGCCGGAGTGAATGCTGTGTGG + Intronic
1183422928 22:37722834-37722856 TGGCCTGTGTGACCCCAGGGAGG - Intronic
1183769616 22:39912774-39912796 TGGCCGGAGTGATGGTGGTGGGG + Intronic
1184787715 22:46679939-46679961 CGGCCTGAGTGACGGCTGTGGGG + Intergenic
1184924303 22:47626362-47626384 TGGTCGGAGCGACTGCGGTGGGG + Intergenic
950712691 3:14824276-14824298 AGGCATGAGTGACTGCCGTGGGG + Intronic
956779916 3:72595738-72595760 GGGCCTGAGTGGCCTAGGTGGGG - Intergenic
957034599 3:75282080-75282102 TGGCCTGTGTGAGCTCGGTTTGG + Intergenic
966313891 3:178624800-178624822 TGTCCCGAGTGACAGAGGTGTGG + Intronic
976845924 4:89489644-89489666 TGCACTGAGAGGCCGCGGTGGGG - Intergenic
983203681 4:164889149-164889171 TGGCCAAAGTAACCTCGGTGAGG + Intronic
984898575 4:184564104-184564126 GGGCCTGAGTGCCCGGAGTGTGG + Intergenic
985555764 5:557240-557262 TGGTCTGAGCGACCTCAGTGGGG - Intergenic
999305968 5:150519882-150519904 TGGCCTGGGTGCAGGCGGTGCGG + Intronic
999461057 5:151758149-151758171 TGGCCTGAAGGAGGGCGGTGGGG - Intronic
1001272664 5:170327260-170327282 TGTCCTAAGTGCCCACGGTGTGG + Intergenic
1013010872 6:106118683-106118705 TGGCCACAGTGACCTCTGTGTGG + Intergenic
1013979547 6:116113612-116113634 TGGGCTGAATGTCCGCTGTGTGG - Intronic
1022488073 7:30795520-30795542 TGGCCTGTGTGACCCTGGAGAGG - Intronic
1023882007 7:44325929-44325951 TGGCCTGCGTGCGCGAGGTGCGG - Intronic
1033424025 7:141227050-141227072 TGGACTGAGAGTCCGCTGTGTGG + Intronic
1036754289 8:11462075-11462097 TGGCCTGAGTGCCCGCAGGCAGG + Intronic
1039924317 8:41915593-41915615 TGGGCTGAGTGACCCGGGAGAGG - Intergenic
1045418525 8:101991207-101991229 TGCCCTGAGTCACCTCAGTGTGG + Intronic
1053367992 9:37537439-37537461 AGGCCTGAGTCCCAGCGGTGAGG - Exonic
1057600325 9:96451089-96451111 AGGCCTGGGCGACCGCGGGGCGG + Intronic
1061842983 9:133370698-133370720 TGGCCTTAGTGCCTGCAGTGCGG - Intronic
1195670737 X:107467728-107467750 AGGCCTCAGTGACCTTGGTGTGG - Intergenic
1200845627 Y:7829313-7829335 TGGCATGAGTGATCCCTGTGGGG - Intergenic