ID: 1130224052

View in Genome Browser
Species Human (GRCh38)
Location 15:82044802-82044824
Sequence GCTGTTCCTCGAGCGCCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130224052_1130224054 -8 Left 1130224052 15:82044802-82044824 CCGCGAGGCGCTCGAGGAACAGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1130224054 15:82044817-82044839 GGAACAGCCCATTGGCTGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130224052 Original CRISPR GCTGTTCCTCGAGCGCCTCG CGG (reversed) Intronic