ID: 1130224052

View in Genome Browser
Species Human (GRCh38)
Location 15:82044802-82044824
Sequence GCTGTTCCTCGAGCGCCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130224052_1130224054 -8 Left 1130224052 15:82044802-82044824 CCGCGAGGCGCTCGAGGAACAGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1130224054 15:82044817-82044839 GGAACAGCCCATTGGCTGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130224052 Original CRISPR GCTGTTCCTCGAGCGCCTCG CGG (reversed) Intronic
900092014 1:924698-924720 GCTGGCCCTCGAGCGCTTCTCGG + Intergenic
901766253 1:11501946-11501968 GCAGATCCTTGAGCACCTCGTGG - Exonic
902467215 1:16625825-16625847 GCTGTTGCTCCAGCGCCTCCTGG + Intergenic
906472874 1:46145768-46145790 GCTGTTCCTTGACCACCTCTTGG + Intronic
915345414 1:155194705-155194727 GCTGCGCCTCGGGCGCCGCGCGG - Intergenic
918260279 1:182789650-182789672 GCGGTTCCGGGCGCGCCTCGCGG + Intronic
1069900668 10:71705033-71705055 GCTGGACCGCGAGCGCATCGCGG + Intronic
1070746005 10:78934324-78934346 GCTGTTTATCTAGCCCCTCGCGG - Intergenic
1071813368 10:89207220-89207242 GCTGTTCCTGCAGCCCCTCTGGG - Exonic
1077066644 11:643999-644021 TCTGTTCCACGAGACCCTCGTGG - Intergenic
1077087822 11:763338-763360 GCTGCTCCTCGAGCTCCCTGCGG - Exonic
1083848978 11:65354606-65354628 GCGGTTCGTCGAGCCCCTCTGGG - Intergenic
1107845527 13:44508787-44508809 GCTGTTCCTCGAGCAAATCAAGG + Intronic
1113799573 13:113079365-113079387 CCTCTTCCTCGAGGGCCTCTGGG - Intronic
1127846491 15:62875640-62875662 GCTGTTCCTCCAGCCCGTCTTGG - Intergenic
1129032444 15:72628943-72628965 GCTGTGCCTCCAGCCCCTTGGGG + Intergenic
1129217446 15:74108296-74108318 GCTGTGCCTCCAGCCCCTTGGGG - Intronic
1130224052 15:82044802-82044824 GCTGTTCCTCGAGCGCCTCGCGG - Intronic
1132568444 16:633775-633797 GCACGTCCTCGAGCGCCACGCGG - Exonic
1132805522 16:1773437-1773459 GCAGGTCCTGAAGCGCCTCGCGG + Exonic
1132907726 16:2291713-2291735 GCTGTTCCTCCAGCCTCACGTGG + Intronic
1132955247 16:2588540-2588562 GCTGTTCTTAGAGGGCCTTGGGG + Intronic
1134069962 16:11254929-11254951 GCTGTGCCGCCAGCGCATCGTGG - Exonic
1134904054 16:17964138-17964160 GCACTTCCTCTAGCGCCTCCAGG + Intergenic
1141643243 16:85353877-85353899 GCTCTTCCTCAAGGGGCTCGTGG - Intergenic
1142128451 16:88421519-88421541 GCTGTCCCTCCAGGGGCTCGGGG - Intergenic
1143855795 17:9847801-9847823 TCTGTTCCTTCAGAGCCTCGTGG + Intronic
1143928428 17:10394395-10394417 GCTGTTCCTTGAGGTCCTCCTGG + Exonic
1146405092 17:32529800-32529822 GCTGTCCCTGGAGAGCCTCTTGG - Intronic
1146762564 17:35491139-35491161 GCTGCTCCTCCTGAGCCTCGGGG + Intronic
1150373399 17:64661510-64661532 GCTGTTCCCCGAGCCCCGGGAGG + Intronic
1150778819 17:68102257-68102279 GCTGTTCCCCGAGCCCCGGGAGG - Intergenic
1152124515 17:78438276-78438298 GCTTGTCCTCGAGCGCCTCTGGG - Intronic
1152745701 17:82037655-82037677 GCTGTTCCTCGCGGGCCGCCGGG - Exonic
1153245243 18:3066861-3066883 GCTTTTCGACGGGCGCCTCGTGG - Exonic
1157755016 18:50210079-50210101 GCTGTTCCTTGAATGCCTCATGG + Intergenic
1162545314 19:11325517-11325539 GCAGGTCTTCGAGCGCCTGGTGG - Exonic
1163424249 19:17232435-17232457 GCTGTTCTTCATGCGCCTGGTGG - Exonic
927809483 2:26173461-26173483 GCGGTTCCTGGCGCGCCTCCCGG + Intronic
948569342 2:238907477-238907499 GCTGTCCCGGGAGCGCCTTGGGG - Intronic
1169082442 20:2805595-2805617 ACTGGTCCTGGAGCTCCTCGAGG + Intergenic
1176212322 20:63930982-63931004 GCTGTGCCTCCAGATCCTCGGGG - Exonic
1176294755 21:5065512-5065534 GCTGTTCCTCTGGCCCCTCCAGG - Intergenic
1181876017 22:25941440-25941462 GCTCTTCCTGGAGCTCCTCAGGG + Intronic
1182550547 22:31098709-31098731 GCCGTTTCTCGAGCGCCGCCAGG - Exonic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
952890861 3:38039606-38039628 GCTGGTCCACGAACTCCTCGTGG - Exonic
968500559 4:947926-947948 GCAGTGCCTCGAGAGGCTCGGGG - Intronic
968897896 4:3415510-3415532 GCAGCTCCTCCTGCGCCTCGTGG + Intronic
975689502 4:76949952-76949974 GCTGCTCCTCGGGCGCCGGGTGG + Intronic
1004013465 6:11711137-11711159 GCTGCTCCTCAAGAGCCTCCTGG + Intergenic
1008648901 6:53544360-53544382 GGGGGTCCTCGAGCGCCTCCCGG - Intronic
1017640395 6:156488052-156488074 CCTGTTCCTCAAGTGCCTCTCGG + Intergenic
1019599579 7:1874611-1874633 GCTCTTCATCGATCGCCTGGTGG + Intronic
1025106380 7:56174895-56174917 GCTGTCCCTGGAGCGCCGGGTGG + Intergenic
1026898313 7:74023198-74023220 GCTGTTCCTACAGTGCCTCACGG - Intergenic
1035896236 8:3405767-3405789 GCTGGTCCTCCAGCTCCTGGCGG - Intronic
1042995764 8:74696404-74696426 CTTGTTCCTCTAGCTCCTCGAGG - Intronic
1049423229 8:142525963-142525985 GCTGTTCCTGGAGCACCCCCGGG - Intronic
1050090644 9:2014911-2014933 CCTCTTCCTCGGGCGCCGCGGGG - Intergenic
1054820638 9:69517096-69517118 GCTGTTCCTCTTCCACCTCGGGG + Exonic
1055923656 9:81488533-81488555 GCTGGTCCTGGAGCCCCCCGAGG - Intergenic
1062109762 9:134775635-134775657 GCTGGTCCGCGTGCGCCTAGGGG - Intronic
1187526247 X:20057717-20057739 CCAGTTCCTGGAGCACCTCGGGG - Intronic
1198312346 X:135435140-135435162 GCTGCTGCTCCAGCGCCTCCTGG - Intergenic
1199599654 X:149534400-149534422 GCTGATCCTGCAGCTCCTCGAGG - Intergenic
1199650979 X:149945810-149945832 GCTGATCCTGCAGCTCCTCGAGG + Intergenic