ID: 1130224437

View in Genome Browser
Species Human (GRCh38)
Location 15:82046370-82046392
Sequence AGAGAGGCGTTAGCGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130224437_1130224442 -7 Left 1130224437 15:82046370-82046392 CCCGCCGCCGCTAACGCCTCTCT No data
Right 1130224442 15:82046386-82046408 CCTCTCTTTGTTGTCTAATGCGG No data
1130224437_1130224443 -6 Left 1130224437 15:82046370-82046392 CCCGCCGCCGCTAACGCCTCTCT No data
Right 1130224443 15:82046387-82046409 CTCTCTTTGTTGTCTAATGCGGG No data
1130224437_1130224445 3 Left 1130224437 15:82046370-82046392 CCCGCCGCCGCTAACGCCTCTCT No data
Right 1130224445 15:82046396-82046418 TTGTCTAATGCGGGACTGGCAGG No data
1130224437_1130224444 -1 Left 1130224437 15:82046370-82046392 CCCGCCGCCGCTAACGCCTCTCT No data
Right 1130224444 15:82046392-82046414 TTTGTTGTCTAATGCGGGACTGG No data
1130224437_1130224446 8 Left 1130224437 15:82046370-82046392 CCCGCCGCCGCTAACGCCTCTCT No data
Right 1130224446 15:82046401-82046423 TAATGCGGGACTGGCAGGCTCGG No data
1130224437_1130224448 17 Left 1130224437 15:82046370-82046392 CCCGCCGCCGCTAACGCCTCTCT No data
Right 1130224448 15:82046410-82046432 ACTGGCAGGCTCGGGACACTTGG No data
1130224437_1130224447 9 Left 1130224437 15:82046370-82046392 CCCGCCGCCGCTAACGCCTCTCT No data
Right 1130224447 15:82046402-82046424 AATGCGGGACTGGCAGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130224437 Original CRISPR AGAGAGGCGTTAGCGGCGGC GGG (reversed) Intergenic
No off target data available for this crispr