ID: 1130225183

View in Genome Browser
Species Human (GRCh38)
Location 15:82051850-82051872
Sequence TTGCCCGTTGATATGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130225172_1130225183 23 Left 1130225172 15:82051804-82051826 CCGCAAGCTGAAGGCCAGAGTAG No data
Right 1130225183 15:82051850-82051872 TTGCCCGTTGATATGGAGCCGGG No data
1130225176_1130225183 -9 Left 1130225176 15:82051836-82051858 CCCCCCAACGTCAATTGCCCGTT No data
Right 1130225183 15:82051850-82051872 TTGCCCGTTGATATGGAGCCGGG No data
1130225175_1130225183 9 Left 1130225175 15:82051818-82051840 CCAGAGTAGGAAATGGCTCCCCC No data
Right 1130225183 15:82051850-82051872 TTGCCCGTTGATATGGAGCCGGG No data
1130225177_1130225183 -10 Left 1130225177 15:82051837-82051859 CCCCCAACGTCAATTGCCCGTTG No data
Right 1130225183 15:82051850-82051872 TTGCCCGTTGATATGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130225183 Original CRISPR TTGCCCGTTGATATGGAGCC GGG Intergenic
No off target data available for this crispr