ID: 1130227273

View in Genome Browser
Species Human (GRCh38)
Location 15:82068862-82068884
Sequence AACAGCCTCAAGTTTAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130227273_1130227276 -10 Left 1130227273 15:82068862-82068884 CCAAGCCTAAACTTGAGGCTGTT No data
Right 1130227276 15:82068875-82068897 TGAGGCTGTTTCTGAATGGCAGG No data
1130227273_1130227278 23 Left 1130227273 15:82068862-82068884 CCAAGCCTAAACTTGAGGCTGTT No data
Right 1130227278 15:82068908-82068930 CAGCCCTCTATCCCCACCCCGGG No data
1130227273_1130227277 22 Left 1130227273 15:82068862-82068884 CCAAGCCTAAACTTGAGGCTGTT No data
Right 1130227277 15:82068907-82068929 ACAGCCCTCTATCCCCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130227273 Original CRISPR AACAGCCTCAAGTTTAGGCT TGG (reversed) Intergenic