ID: 1130228942

View in Genome Browser
Species Human (GRCh38)
Location 15:82081904-82081926
Sequence CTCAGTCTTGTCTGCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130228940_1130228942 21 Left 1130228940 15:82081860-82081882 CCAGGCTTGAATCTCAGCTCTAC No data
Right 1130228942 15:82081904-82081926 CTCAGTCTTGTCTGCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130228942 Original CRISPR CTCAGTCTTGTCTGCAAATT TGG Intergenic
No off target data available for this crispr