ID: 1130230002

View in Genome Browser
Species Human (GRCh38)
Location 15:82089478-82089500
Sequence CTCAAAAAATAAATGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130229994_1130230002 25 Left 1130229994 15:82089430-82089452 CCAGGAAGGAAGGGAAAGGACCC No data
Right 1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG No data
1130229996_1130230002 4 Left 1130229996 15:82089451-82089473 CCAGCCGAGTCCTTCTCCTGATC No data
Right 1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG No data
1130229997_1130230002 0 Left 1130229997 15:82089455-82089477 CCGAGTCCTTCTCCTGATCTTGA No data
Right 1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG No data
1130229995_1130230002 5 Left 1130229995 15:82089450-82089472 CCCAGCCGAGTCCTTCTCCTGAT No data
Right 1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG No data
1130229992_1130230002 29 Left 1130229992 15:82089426-82089448 CCTGCCAGGAAGGAAGGGAAAGG No data
Right 1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG No data
1130229998_1130230002 -6 Left 1130229998 15:82089461-82089483 CCTTCTCCTGATCTTGACTCAAA No data
Right 1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130230002 Original CRISPR CTCAAAAAATAAATGGAGGT TGG Intergenic
No off target data available for this crispr