ID: 1130232875

View in Genome Browser
Species Human (GRCh38)
Location 15:82109866-82109888
Sequence CTTAGTAAGGGTCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130232868_1130232875 4 Left 1130232868 15:82109839-82109861 CCATGATGAAGGCCACAGAGTGT No data
Right 1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG No data
1130232869_1130232875 -8 Left 1130232869 15:82109851-82109873 CCACAGAGTGTTTAACTTAGTAA No data
Right 1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG No data
1130232867_1130232875 5 Left 1130232867 15:82109838-82109860 CCCATGATGAAGGCCACAGAGTG No data
Right 1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG No data
1130232864_1130232875 27 Left 1130232864 15:82109816-82109838 CCATGCTAAGGGGCGAGGTGACC No data
Right 1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG No data
1130232866_1130232875 6 Left 1130232866 15:82109837-82109859 CCCCATGATGAAGGCCACAGAGT No data
Right 1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130232875 Original CRISPR CTTAGTAAGGGTCAGGTGGA GGG Intergenic
No off target data available for this crispr