ID: 1130235766

View in Genome Browser
Species Human (GRCh38)
Location 15:82132214-82132236
Sequence CTGCCTCAGCACCAGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130235766 Original CRISPR CTGCCTCAGCACCAGGACAC AGG (reversed) Intronic
900609519 1:3538588-3538610 CTCCCTCAGAGCCAGGAGACAGG - Intronic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
901082107 1:6589301-6589323 CTTCCCCAACTCCAGGACACGGG - Intergenic
902388467 1:16089156-16089178 CTGACTCAGCGCCTGGACACTGG + Intergenic
904431310 1:30466263-30466285 CTGCCTCAACTCCAGGTCTCAGG + Intergenic
904577970 1:31517677-31517699 CTGCCTTATCACAAGGACAGAGG + Intergenic
904580310 1:31538488-31538510 CAGCTTGACCACCAGGACACCGG - Intergenic
904863918 1:33561634-33561656 CTATCTCAGCACCAGCCCACTGG - Intronic
905013177 1:34760515-34760537 AGGCCCCAGCACCAGTACACGGG + Intronic
905350331 1:37341379-37341401 CTGCCTTGAAACCAGGACACTGG + Intergenic
906534391 1:46543722-46543744 CAGCCTGAGCTCCAGGAGACAGG - Intergenic
907032261 1:51184008-51184030 CTGCCTCAGCCCCAAGAAGCTGG + Intergenic
907342591 1:53747460-53747482 CTGCCTCAGCCCCAAGAGGCTGG - Intergenic
908618125 1:65946099-65946121 CTCCCTCATCAACAGGTCACAGG + Intronic
909974321 1:82027364-82027386 CTGCACCAGCACCAGGATGCAGG - Intergenic
911084152 1:93962654-93962676 ATGCCTCAGGACCAGAACTCAGG - Intergenic
911430051 1:97773924-97773946 CTGCCTTATCACAAGGACAGAGG - Intronic
912593521 1:110851256-110851278 CTGCCTCACCACCTGGATGCAGG - Intergenic
914195685 1:145446884-145446906 CAGCCCCAGCCCCAGAACACGGG + Intergenic
914389722 1:147209027-147209049 TTTCCTCAGCACCAGGAGAGGGG - Exonic
915117025 1:153607685-153607707 CTGCTTCCTCCCCAGGACACAGG - Exonic
915841908 1:159220161-159220183 CTGTCTAAGAACCAGGAAACTGG - Intergenic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
916356617 1:163917055-163917077 CTGCAACAGCACCAGTACACAGG - Intergenic
917883275 1:179360318-179360340 CTGCCTCAGTAACAGCACATTGG - Intergenic
919183713 1:194117960-194117982 CTGCCTGATCACAAGGACAGAGG + Intergenic
919765896 1:201127214-201127236 CTGCCACAGCACCGGGAGCCAGG + Intergenic
919922100 1:202172010-202172032 GGGCCCCAGCACCAGGACAGCGG + Intergenic
921011970 1:211150665-211150687 CCACCTCAGCTCCAGGAAACTGG + Intergenic
922676804 1:227558551-227558573 CCGCCACAGCACCAGGAGCCTGG + Intergenic
922686089 1:227639715-227639737 CTGCCTCTGCACCAGTAGGCTGG + Intronic
923048947 1:230376708-230376730 CTGCCTCAGCCCCAGACCTCGGG - Intronic
923109906 1:230882395-230882417 CTGCCTTATCGCCAGGACAGAGG + Intergenic
923252701 1:232191982-232192004 CTGCCTTATCACAAGGACAGAGG - Intergenic
924553509 1:245099488-245099510 CTGCCCCGACACCAGGCCACAGG + Intronic
1063386873 10:5621301-5621323 AGGCCTCAGCAGCAGGACAGTGG + Intergenic
1063631482 10:7738450-7738472 CTCCCTCAGCAACATGACAGAGG + Intronic
1064125807 10:12658926-12658948 CTGCCTTATCACAAGGACAGAGG - Intronic
1064273560 10:13886412-13886434 CTGCATTAGGACCAGGACTCCGG + Intronic
1064795800 10:19009904-19009926 CTGCCTTATCACAAGGACAGAGG + Intergenic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065603625 10:27393885-27393907 CTGCCCAAGCAACATGACACGGG - Intergenic
1067712044 10:48657198-48657220 CTGCCACAGCACCAGAGCTCAGG + Intergenic
1067825472 10:49569308-49569330 CTGCCTCAGTGCAAGGAGACAGG - Intergenic
1069394109 10:67969626-67969648 CTCCCTCAGCAACAAGACATGGG - Intronic
1070493578 10:77000021-77000043 CAGCCTCAACACCAGCACAGGGG + Intronic
1071893775 10:90041851-90041873 CTGCCTTATCACAAGGACAGAGG + Intergenic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1072790670 10:98315452-98315474 CTACCTCATCACCAGGAGAAAGG - Intergenic
1073311381 10:102545223-102545245 CTGCCTCAGCACCCCCACCCTGG + Intronic
1073317629 10:102593892-102593914 CTGCCCCAGGCCTAGGACACAGG - Intronic
1074438966 10:113458423-113458445 CTGACTCAGGTCCAGGACAGTGG + Intergenic
1076558332 10:131344814-131344836 CTTCCTCAGCACCAGGCTCCAGG - Intergenic
1076871191 10:133195915-133195937 TGGCCTCATCACCTGGACACTGG - Intronic
1077080837 11:724102-724124 TTCCCTGAGCACCTGGACACGGG + Intronic
1078113904 11:8426045-8426067 CTGCCTCATCACAAGGACAGAGG + Intronic
1079392060 11:20031084-20031106 CTGTTTCAGGACCAGGACACAGG + Intronic
1080162153 11:29189868-29189890 CTGCCCCAGCTCCAGGACAAAGG - Intergenic
1081232903 11:40607735-40607757 CTGCCTCATCACAAGGAGAGAGG - Intronic
1081669262 11:44934054-44934076 CTGCCTCTACCCTAGGACACTGG - Exonic
1082295921 11:50441181-50441203 CTGCCACAACACCAGGAAAATGG + Intergenic
1083388779 11:62333074-62333096 CTGCCTTATCACAAGGACAGAGG + Intergenic
1083418278 11:62539359-62539381 CTGGCACAGCACCAGGATGCTGG - Intronic
1084362414 11:68677563-68677585 CTGACTCAGGGCCAGGAAACAGG + Intergenic
1087816496 11:102664373-102664395 CTGCCTTATCACAAGGACAGAGG - Intergenic
1089047560 11:115516275-115516297 AGGCCTCACCACCAGGATACCGG - Intergenic
1089460335 11:118649404-118649426 ATGCCTGAGCCCCAGGACAGGGG - Intronic
1089611500 11:119672031-119672053 CTGCCTCCCTTCCAGGACACTGG + Intronic
1090409171 11:126495787-126495809 CAGCCTGAGGATCAGGACACTGG + Intronic
1091785910 12:3243344-3243366 CTGCCGCAGCCCCAGGAGGCAGG + Intronic
1092163438 12:6328525-6328547 CCGCCTCAGCCTCCGGACACAGG - Intergenic
1092570004 12:9710979-9711001 CTGCCTTATCACAAGGACAGTGG - Intergenic
1094361756 12:29638538-29638560 CAGCCTTATCACCAGGACAGAGG - Intronic
1096198656 12:49665509-49665531 TTGGCCCAGCACCAGGCCACAGG + Intronic
1096477329 12:51916186-51916208 CTCCCACAGCACCAGGCCAAAGG - Exonic
1096576811 12:52557902-52557924 CTGCCTCCCCACCAGGCCAGAGG - Intergenic
1096889202 12:54749634-54749656 CTGCCTCAGACCCTGGGCACTGG + Intergenic
1099653309 12:85456874-85456896 CTGCCTTATCACAAGGACAGAGG - Intergenic
1101554955 12:105800316-105800338 CTGCCTCAGGACCTTCACACAGG - Intergenic
1102569936 12:113821278-113821300 CTGCCTCTGCACCAGGCCCGTGG + Intronic
1102705405 12:114876159-114876181 CTGCCTCAGGCCCAGCAGACAGG - Intergenic
1102955341 12:117055032-117055054 GTGCCTCAGCTCTGGGACACTGG + Intronic
1104729861 12:131098730-131098752 CAGCCTCATCAACACGACACTGG + Intronic
1104787325 12:131457931-131457953 CTGCCTCAGGGTCAGGACCCTGG - Intergenic
1104880677 12:132068438-132068460 GTGCCACACCACCTGGACACTGG + Intronic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1105673402 13:22644374-22644396 CTGCCTTATCACAAGGACAGAGG + Intergenic
1106901626 13:34359988-34360010 CTGCCACAGTTACAGGACACTGG - Intergenic
1106941047 13:34779527-34779549 CTGCTTAAGAAACAGGACACCGG - Intergenic
1111198028 13:84898704-84898726 CTGCCTTATCACAAGGACAGAGG + Intergenic
1113657369 13:112075855-112075877 CATCCTCAGCACCTGGACACAGG - Intergenic
1113860668 13:113483751-113483773 CTGCCCCGGCACCAGAACCCTGG + Intronic
1115787256 14:36840070-36840092 CTCCCACAGCAGCAGCACACAGG + Intronic
1117021539 14:51575937-51575959 CCCCATCAGCACCAGGCCACTGG + Intronic
1117329838 14:54701647-54701669 CAGCCTCACCCCCAGGACTCTGG + Intronic
1117989319 14:61418292-61418314 CCTCCTTATCACCAGGACACAGG - Intronic
1118487213 14:66225227-66225249 CTGCCTTATCACAAGGACAGAGG - Intergenic
1119855510 14:77897406-77897428 CTGCCCCACCACCAGGGCCCTGG - Intronic
1121016925 14:90554528-90554550 CTGGCACAGCACCAGGACATTGG - Intronic
1121864391 14:97348797-97348819 CTGCCTCTTCACGAGGGCACAGG + Intergenic
1122649126 14:103216047-103216069 CGGCCTCAGCACCAGGCAGCAGG - Intergenic
1124405295 15:29386181-29386203 CTGCCTTATCACAAGGACAGAGG - Intronic
1124880507 15:33638219-33638241 TTGCCTCTGAACCAGCACACAGG - Intronic
1126246890 15:46517947-46517969 CTACCTCAGCAGGAGGAAACTGG + Intergenic
1126484176 15:49160753-49160775 CTGCCTCAGCATCAGGTAGCTGG - Intronic
1127703865 15:61528099-61528121 CAGTCTCAGGACCAGGACCCGGG + Intergenic
1129108499 15:73324254-73324276 CTGCCAGAGCATCAGGACTCAGG + Intronic
1129450774 15:75649967-75649989 CTGCCTGAGAAGCAGGCCACTGG + Exonic
1129772814 15:78213532-78213554 CTGCCTCATCACCCGGAACCTGG - Intronic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1131301035 15:91199818-91199840 CTGCCTCATCATCATCACACAGG - Intronic
1132155525 15:99492973-99492995 CAGCCTCAGCTACAGGCCACGGG - Intergenic
1132304393 15:100801016-100801038 CTGCCTCTGGATGAGGACACCGG + Intergenic
1132578690 16:675494-675516 CTGGCGCAGCTCCAGCACACTGG - Intronic
1132622367 16:873916-873938 CTCCCTGAGCACCATGACCCTGG - Intronic
1132802221 16:1760032-1760054 CTGCCTCAGCCCCACCACACAGG - Intronic
1133036934 16:3038733-3038755 CTGTCCCAGCCCCAGGACCCAGG - Intergenic
1133058496 16:3159221-3159243 CTGCCTCAGCGCCAGGCCTTAGG - Intergenic
1133202887 16:4215239-4215261 CTGCCTCAGCCCCTGCACTCTGG - Intronic
1133452980 16:5919054-5919076 CTGCCTCAGCTCTCAGACACTGG - Intergenic
1134053936 16:11157367-11157389 CTTCTTCAGCACCAGTGCACAGG + Intronic
1134181961 16:12055091-12055113 CCGCCTCAGCCCCACCACACTGG - Intronic
1134797711 16:17056947-17056969 CTGCCACAGACCCAGGACTCAGG - Intergenic
1135043462 16:19135752-19135774 CTCCCTCAGCCCCAGCACAGTGG - Intronic
1136866637 16:33763957-33763979 CTGCCTCACCACAAGAACTCTGG + Intergenic
1137373009 16:47926219-47926241 TTGCCACAGCACCAGGTAACAGG - Intergenic
1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG + Intronic
1139582091 16:67879804-67879826 ATGCCTCAGCCACAGGCCACAGG + Intronic
1142115121 16:88352505-88352527 ATGGCTCAGCACCAGGCCACTGG + Intergenic
1143465505 17:7133820-7133842 CTGCCTCATCACAAGCACAGAGG + Intergenic
1143766365 17:9140323-9140345 CTGCCACAGCACCAGGGCAGGGG - Intronic
1144621313 17:16820275-16820297 CTGCCTCATCCCCAGGCCCCAGG - Intergenic
1144849654 17:18237635-18237657 CAGGCACTGCACCAGGACACGGG - Exonic
1146067035 17:29644166-29644188 CTGCCTCCGCAGCAGCAAACAGG - Intronic
1147949169 17:44097455-44097477 CTGCCCCAGCACCAGGAGAAAGG + Intronic
1147999672 17:44380374-44380396 CTGCCTCCTCACCAGCTCACGGG + Exonic
1148859290 17:50595700-50595722 CTGCCCCAGCACCAGAATTCGGG + Intronic
1149268347 17:54951879-54951901 CTGACTCTCCACAAGGACACAGG + Intronic
1149458088 17:56805451-56805473 CTGCCCCAGCAACAGCCCACTGG + Intronic
1150787807 17:68176902-68176924 CTGCCTAAGCCCCAGGACCTAGG - Intergenic
1151679812 17:75617259-75617281 CTGCCTCTGCCCGAGGACCCAGG + Intergenic
1152782916 17:82234328-82234350 TTGCCTCTGCACCTGGACACCGG - Exonic
1153310194 18:3669809-3669831 CTTCCTCATCACAAGGACAGAGG - Intronic
1155351861 18:24914843-24914865 CTAGCACAGCACCAGGACTCAGG + Intergenic
1158545070 18:58389216-58389238 CTGCCTCAGGTGGAGGACACCGG - Intronic
1158856084 18:61544373-61544395 CTGCCTTATCACAAGGACACAGG + Intronic
1160936790 19:1599896-1599918 CTGCCACAGCTGCAGGACTCAGG + Intronic
1161170189 19:2808604-2808626 CTGGGGCAGCCCCAGGACACGGG - Intronic
1161172662 19:2820653-2820675 CTGTCTTATCACCAGGACAGCGG - Intronic
1161247117 19:3259270-3259292 CTGCCCCCGCCCCAGGACACTGG + Intronic
1161548248 19:4895578-4895600 CCGCCTCTGCACCTGGACTCGGG + Intronic
1161899680 19:7109277-7109299 CTGACTCAGGACAAGAACACGGG - Intergenic
1162211290 19:9094179-9094201 CTTCCTGACCACCAGGACTCAGG + Exonic
1162637828 19:11984342-11984364 CTGCCTTATCACAAGGACAGAGG + Intergenic
1164769880 19:30800357-30800379 CTGCATGGGGACCAGGACACAGG - Intergenic
1165149414 19:33752086-33752108 CTGCCTGAGCCCCAGGACGAAGG + Intronic
1167095683 19:47373833-47373855 CTGCCCCAACACCTGGTCACCGG - Intronic
1167328190 19:48837620-48837642 CTCCCTCAGACCCAGGACTCCGG + Intronic
1167497683 19:49829130-49829152 CTGCCTCAGACCCAAGACTCCGG - Intronic
1167529682 19:50007513-50007535 TCGTCTCAGCACCAGGACAGTGG - Intronic
1167795401 19:51704969-51704991 CTCCCTCAGAACCAGGAGTCCGG + Intergenic
1168254438 19:55157955-55157977 CTCCCTCAGTCCCAGGACCCTGG + Intronic
1168270791 19:55248695-55248717 CTGACTCAGCCCCAGGCCCCAGG + Intronic
925896929 2:8479589-8479611 CTGGCTCAGCAGTAGAACACAGG + Intergenic
926961665 2:18364496-18364518 CTGCCTTATCACAAGGACAGAGG + Intergenic
928819359 2:35342319-35342341 CTGCCTTATCACAAGGACAGAGG - Intergenic
930309036 2:49714464-49714486 CTGCCTAATCACAAGGACAGAGG - Intergenic
932403912 2:71500848-71500870 CTGAGTCAGCCCCAGGACCCGGG - Intronic
933187148 2:79290873-79290895 CTGCCTTATCACAAGGACAGAGG - Intronic
933315241 2:80706946-80706968 CTGCCTTATCACAAGGACAGAGG - Intergenic
934165239 2:89288362-89288384 CTGTCTCACAGCCAGGACACAGG + Intergenic
934202035 2:89894100-89894122 CTGTCTCACAGCCAGGACACAGG - Intergenic
934605891 2:95694844-95694866 CTGCCTCTCCCCCAGGTCACTGG - Intergenic
934635339 2:95982546-95982568 CTGCCTCACCACAAGAACTCTGG + Intronic
934798293 2:97122677-97122699 CTGCCTCACCACAAGAACTCTGG - Intronic
934810002 2:97269803-97269825 CTCTGTCAGCCCCAGGACACTGG - Intergenic
934827690 2:97438136-97438158 CTCTGTCAGCCCCAGGACACTGG + Intergenic
934835133 2:97580752-97580774 CTGCCTCACCACAAGAACTCTGG + Intronic
935470682 2:103456162-103456184 GTGTCCCAGCTCCAGGACACCGG - Intergenic
936981293 2:118267764-118267786 CTGCCTCTGTACCAGGCAACTGG + Intergenic
937743686 2:125386364-125386386 CTGCCTTATCACAAGGACAGAGG + Intergenic
937986708 2:127641303-127641325 CAGCCTCAGCCCCAGGAGTCAGG + Intronic
938178953 2:129162629-129162651 CTGCCCCAGCCCCAGGATGCAGG + Intergenic
939243827 2:139597079-139597101 CTGCCTCAGCCTCTGTACACTGG - Intergenic
939451184 2:142376555-142376577 CTGCCTTATCGCAAGGACACAGG - Intergenic
942871573 2:180740542-180740564 CTGCCTGAGCACCAGGCCAAGGG - Intergenic
946210444 2:218143397-218143419 CTGCCTTATCACAAGGACAGAGG + Intergenic
946230873 2:218290607-218290629 CTACCACAGAACCAGGAAACGGG + Intronic
946301727 2:218828145-218828167 GTGTCTCAGCACAAGGACACTGG - Intronic
946396852 2:219447718-219447740 CAGACTCAGCCCCAGGACTCGGG - Intronic
947302233 2:228700909-228700931 CTGCCTCAAGAACAGCACACAGG - Intergenic
949067139 2:241998979-241999001 CAGCCTCAGGAACAGGACTCGGG - Intergenic
1168849138 20:964555-964577 AGCCCTCAGGACCAGGACACAGG + Intronic
1169029612 20:2397305-2397327 CTGCCTGAGCTCCAGGTCCCCGG + Intronic
1169292560 20:4365175-4365197 CTTCCTCAGCCCCAGGACTCTGG + Intergenic
1171150894 20:22825735-22825757 CTGCCTCAGCCTCAGGGCAGAGG - Intergenic
1171220050 20:23388034-23388056 CTGTCTTAGAGCCAGGACACTGG + Intronic
1171371688 20:24666307-24666329 CTGCCTCAGCCTAAAGACACAGG + Exonic
1172329996 20:34068864-34068886 CTCCCTCAGCCCAAGGAGACAGG - Intronic
1172634619 20:36401539-36401561 CTTGCTCAGCACTAGGGCACTGG - Intronic
1172982373 20:38953590-38953612 CTGCCACTGGACCAGGAAACTGG - Intergenic
1173482005 20:43409164-43409186 CTGCCTCTGCCCCAAGTCACAGG + Intergenic
1173500542 20:43549640-43549662 CCACATCAGCACCTGGACACGGG - Intronic
1175187474 20:57188751-57188773 CTGCCTCACCAGCAGCAGACTGG + Intronic
1175756466 20:61533406-61533428 CTGCCTCTGCAGCAGGACTTGGG - Intronic
1176088332 20:63308017-63308039 CTCCCTCAGCACCAAGGAACAGG + Exonic
1176103233 20:63373967-63373989 CTGCCTGAGCACCAGAACCCGGG - Intronic
1176206171 20:63889420-63889442 CAGCCTCCCCACCAGGACATTGG + Intronic
1176300474 21:5096702-5096724 CATCCTCAGCACCAGGACCACGG + Intergenic
1176986565 21:15444456-15444478 CTGCCACAGAACGATGACACAGG - Intergenic
1178438695 21:32581411-32581433 CTGCCTTATCACAAGGACAGAGG - Intronic
1178591031 21:33910248-33910270 CTGCCTCTGATCCAGGATACTGG + Intronic
1179509881 21:41865436-41865458 CCTCCTCGGCACCAGCACACGGG + Intronic
1179819115 21:43926157-43926179 CTGGGTCAGCACCAGGGTACAGG + Intronic
1179856569 21:44165279-44165301 CATCCTCAGCACCAGGACCACGG - Intergenic
1179884384 21:44307184-44307206 CTGCCTCACCACCCAGACCCGGG + Intronic
1180024043 21:45148449-45148471 CTGCCTTAGCACCAGGGCCTGGG + Intronic
1180181863 21:46121664-46121686 CTGCCTGAGGAGCAGGACAGGGG + Intronic
1181040629 22:20190923-20190945 CTGCCTTATCACAAGGACAGAGG - Intergenic
1181985412 22:26796943-26796965 CTGCCTCATCAGCAGGACCATGG - Intergenic
1182321370 22:29480199-29480221 CTGCGGCAGCACCAGGGCGCCGG - Intergenic
1184177656 22:42798237-42798259 TTCCCTCAGCCCCAGGACTCTGG - Intronic
1184345528 22:43910355-43910377 CTGCTTCACCACCAGGAGGCTGG + Intergenic
1184890270 22:47375019-47375041 CTGCTTCAGAAACAGGACAGAGG - Intergenic
1184934103 22:47706472-47706494 CTTCCTTATCACAAGGACACAGG + Intergenic
1184945545 22:47801533-47801555 CTCCCACAGCACAAGGACTCAGG - Intergenic
1185122667 22:48981859-48981881 CGACCTCAGCACCAGGCCAAGGG - Intergenic
949659238 3:6258612-6258634 CTGACTCAGCACAAGAAAACAGG - Intergenic
949887238 3:8705803-8705825 CTGTCTGAGCTCCAGGCCACAGG - Intronic
950181288 3:10915231-10915253 CTGCCACTGCCCCAAGACACAGG - Intronic
951218014 3:20041706-20041728 CTGCCTCAGCCACAGGCCGCAGG - Intronic
951678442 3:25268641-25268663 CTGCCTCAGCACCTTTGCACTGG + Intronic
952551630 3:34485179-34485201 CTGTCTCAAGACAAGGACACTGG + Intergenic
952866728 3:37860355-37860377 CTGCATCAGCTCCAGGATCCAGG + Intergenic
953732778 3:45464469-45464491 CTGTCTCAGCCCCAGAACAGAGG + Intronic
953772205 3:45786498-45786520 GTGCCTCTGGACAAGGACACAGG - Intronic
956194135 3:66635219-66635241 CTGCCTTATCACAAGGACAGAGG - Intergenic
956390858 3:68771245-68771267 CTGCCTTATCACAAGGACAGAGG - Intronic
956631787 3:71323855-71323877 TTGCTTCACCAGCAGGACACAGG + Intronic
956718394 3:72098218-72098240 CTGCCTCAGCACCATGGCTCAGG - Intergenic
956735252 3:72233119-72233141 CTGCCTTATCACAAGGACAGAGG + Intergenic
956778638 3:72587292-72587314 CTGCCTTATCACAAGGACAGAGG - Intergenic
958634563 3:96726941-96726963 TTGCCTCTGCTCCAGGACATAGG - Intergenic
958663733 3:97106648-97106670 CTGCCTTATCACAAGGACAGAGG - Intronic
960515209 3:118595638-118595660 CTGCCTTATCACAAGGACAGAGG + Intergenic
960615955 3:119596175-119596197 CAGCCTCAGCACAAAGACAGAGG - Intergenic
961319581 3:126063535-126063557 CTCCCTCTGCACCTGGGCACAGG + Intronic
961485331 3:127211913-127211935 CTGACTCAGGTGCAGGACACAGG + Intergenic
961625126 3:128256511-128256533 CCTCATCAGCACCAAGACACTGG + Intronic
961647131 3:128398598-128398620 CTGCCCCAGGGCCCGGACACGGG - Intronic
963253747 3:143123340-143123362 CAGCCTCAGCACCAAAACATTGG - Intergenic
965722191 3:171674171-171674193 CTGCCTAAGCACCAGGAATGTGG - Intronic
965833801 3:172828951-172828973 CTGCCTCAGCACCAATAAATTGG + Intergenic
968813985 4:2812403-2812425 CTCCCTGGGCCCCAGGACACCGG + Intronic
970233370 4:13933607-13933629 CTGCCTTATCACAAGGACATAGG + Intergenic
971759823 4:30751003-30751025 CTGCTTCTGCACCATAACACAGG - Intronic
972249137 4:37280912-37280934 GAGCCACAGCACCAGGCCACAGG - Intronic
972701822 4:41501690-41501712 GTGCCTCATCACCAGGAAAAGGG - Intronic
973057426 4:45678680-45678702 CTGCCTTATCACAAGGACAGAGG + Intergenic
974250077 4:59374769-59374791 CTGCCTTATCACAAGGACAGAGG + Intergenic
974250616 4:59378553-59378575 CTGCCTTATCACAAGGACAGAGG + Intergenic
974394337 4:61315328-61315350 CTGCCCCATTTCCAGGACACAGG + Intronic
977045175 4:92060661-92060683 CTGCCTTATCACAAGGACAGAGG + Intergenic
978125356 4:105129261-105129283 TTGCCTCAAGACCAGGACAAGGG - Intergenic
979859546 4:125676600-125676622 CTGCCTTATCACAAGGACAGAGG - Intergenic
979859696 4:125677986-125678008 CTGCCAGAGCATCAGGACTCAGG - Intergenic
979862111 4:125707187-125707209 CTTCCTTATCACAAGGACACAGG + Intergenic
980485465 4:133451267-133451289 CTGCCTTATCACAAGGACAGAGG - Intergenic
980574083 4:134662996-134663018 CAGCCTCAGCAGCAGGGCAGTGG - Intergenic
985100276 4:186451644-186451666 CTGCAACAGCAACAGGAAACTGG + Intronic
985665460 5:1179650-1179672 CCCCCTCCGCACCTGGACACGGG + Intergenic
985957593 5:3276581-3276603 CGGCCTCAGCAGCAAGACAGTGG + Intergenic
986059124 5:4171371-4171393 CTCCCTAAGCACCAGGTCAGAGG - Intergenic
986157299 5:5189163-5189185 TTACCTCAGCTTCAGGACACTGG - Intronic
987137586 5:14914138-14914160 CTGCCTCACCAGCAGGAAATAGG - Intergenic
987145941 5:14991833-14991855 CTGCCTCTGAACTAGGACGCTGG + Intergenic
989996208 5:50835425-50835447 CTGCCTCAGCCCCAGGAGCTGGG - Intronic
991439662 5:66633963-66633985 CTGCCTCATTATGAGGACACAGG + Intronic
991917644 5:71620957-71620979 CTGCATCTGCATCAGGACAGAGG - Intronic
992169166 5:74085147-74085169 CTGCCTCAGCACACAGGCACTGG + Intergenic
992828061 5:80569402-80569424 CAGCCTTGGCACCAGGATACCGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994661675 5:102661374-102661396 CTGCCTTACCACAAGGACAGAGG - Intergenic
997486621 5:134236377-134236399 TGGCCTCAGCACCAGCACATGGG - Intergenic
997625510 5:135328206-135328228 CTGCCTCACCCCAAGGGCACAGG - Intronic
997889568 5:137663346-137663368 CAGCCCCAGCCCCAGGGCACTGG + Intronic
998205194 5:140152703-140152725 CTGCCTCAGGACCAGGACTTTGG + Intergenic
999536978 5:152528544-152528566 CTGCCTTATCACAAGGACAGAGG + Intergenic
1002475688 5:179464445-179464467 CTGCCTTATCACAAGGACAGAGG + Intergenic
1002478684 5:179484984-179485006 CTGCCCCAGGACCAGGGCATTGG + Intergenic
1002685467 5:181005855-181005877 CTGTCTCATCCCCAGGACACTGG - Exonic
1002807976 6:596276-596298 ACGCCTCATCACTAGGACACAGG + Intronic
1003762753 6:9198865-9198887 CTGCCTTGGCCTCAGGACACAGG - Intergenic
1004176641 6:13345877-13345899 TTGCCTCATCACCAGGACAATGG + Intergenic
1005651085 6:27885655-27885677 CTGCCTCAGCCCGAGTATACAGG + Intergenic
1006429594 6:33987645-33987667 TCGCCTCTGCCCCAGGACACAGG - Intergenic
1006731039 6:36236280-36236302 CTGCCTTATCACAAGGACAGAGG - Intergenic
1006903421 6:37517274-37517296 CTGCAGCAGCTGCAGGACACAGG + Intergenic
1007307597 6:40919041-40919063 CTGCCTTATCACAAGGACAGAGG - Intergenic
1007482677 6:42160355-42160377 CAGGCTCAGCCCCAGGGCACAGG - Intronic
1007500908 6:42296110-42296132 CCACCACGGCACCAGGACACAGG + Intronic
1009396453 6:63205422-63205444 CTGCCTCAGGACCACAGCACTGG + Intergenic
1010326281 6:74566448-74566470 CTGCCTCAGCATCTGGAGATGGG - Intergenic
1010533310 6:76992620-76992642 CTGCCTTATCACAAGGACAGAGG - Intergenic
1011607759 6:89120604-89120626 CTCCCACAGCACCAGGATACAGG - Intergenic
1012606608 6:101166019-101166041 CTGCTGCAGCACCAGAGCACAGG - Intergenic
1013381218 6:109573234-109573256 CTGCCCCAGCACTGGCACACAGG - Intronic
1013519992 6:110924182-110924204 TTGCAGCAGCACCAGGGCACAGG - Intergenic
1014169834 6:118266704-118266726 CTGCCCCAGCACCTGGAGGCAGG + Intronic
1014247223 6:119081550-119081572 CTGCCTTATCACAAGGACAGAGG + Intronic
1014323822 6:119966517-119966539 CTGCCTTACCACAAGGACAGAGG - Intergenic
1016292221 6:142538358-142538380 CTGCCTCTGCACCAGTAGGCTGG - Intergenic
1016684425 6:146865143-146865165 CAGCCTCAGGACCATGTCACAGG - Intergenic
1017130709 6:151106298-151106320 CTGCCACAGAACCAGGACCTAGG - Intergenic
1018332610 6:162747550-162747572 ATGTATCAGCACCAGTACACTGG + Intronic
1018987661 6:168649859-168649881 CTGCCCCAGTAGCTGGACACAGG - Intronic
1019142621 6:169957705-169957727 CTGGCGCAGCACCTGGACACGGG + Intergenic
1019699834 7:2469189-2469211 CTCCCTCTCCACCAGGACAGAGG - Intergenic
1020720660 7:11740546-11740568 CCCCCTCAGCAGCTGGACACAGG + Intronic
1021629160 7:22626865-22626887 CCGCCTCAGATCCAGGACAAAGG + Intronic
1021856183 7:24858812-24858834 CTGCCTCCTCAGCAGGACAAAGG - Intronic
1021866522 7:24963555-24963577 CTGCCTATGCACAAGGACCCTGG + Intronic
1022406276 7:30093186-30093208 CTGCTGCAGCATCAGGACACTGG + Intronic
1022878762 7:34564212-34564234 CTGGCTCACCACCATGACACAGG - Intergenic
1024457021 7:49620093-49620115 CTGCCTCAGCCTCAGGAGGCTGG - Intergenic
1024943808 7:54788912-54788934 CTGTCTCAGCTCCACGACAGTGG + Intergenic
1025020204 7:55474652-55474674 CTACAGCAGCACCAGGACAAGGG + Intronic
1025027003 7:55524877-55524899 CAGCACCAGCACCAGGACTCAGG + Intronic
1025820216 7:64955700-64955722 CTTCCTTATCACCAGGACAGGGG - Intergenic
1026271994 7:68844798-68844820 CTGTCTAATCACCAGGACCCAGG + Intergenic
1026557756 7:71422754-71422776 CTGCCTTATCACAAGGACAGAGG + Intronic
1027525942 7:79268837-79268859 CTGCCTCAACACCGTGACATGGG + Intronic
1029375300 7:100173859-100173881 CTGTCTCAGCAGCAGGGGACTGG - Exonic
1032316269 7:130841832-130841854 CTGCCTTATCACAAGGACAGAGG + Intergenic
1032741924 7:134748077-134748099 CTGCCCCAGCACCTAGACAGTGG + Intronic
1033237956 7:139653275-139653297 CTGCCTCAGCACCATGGCATAGG - Intronic
1033381228 7:140821410-140821432 CTGCCTCAGCTCCAAGTAACTGG + Intronic
1033418482 7:141185244-141185266 CTGCCTTATCTCCAGGACAGAGG + Intronic
1034215040 7:149398668-149398690 TTGCCTCAGGCCCGGGACACTGG + Intergenic
1034330612 7:150279053-150279075 CTGCCTCAGCCCCAAAGCACTGG - Intronic
1034667430 7:152830796-152830818 CTGCCTCAGCCCCAAAGCACTGG + Intronic
1035253523 7:157612477-157612499 ACGCCTTATCACCAGGACACAGG + Intronic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1036694936 8:10968115-10968137 CTGCCTGAGCTCCAGGATCCAGG - Intronic
1037889888 8:22618510-22618532 CTGCCCCAGCACATGGGCACAGG + Intronic
1038248615 8:25882058-25882080 CTGCCTTATCACAAGGACAGAGG - Intronic
1038346609 8:26737836-26737858 CAGCTGCAGCAGCAGGACACGGG + Intergenic
1038660809 8:29495041-29495063 CTGCCTCAGAAGCAAGAAACAGG - Intergenic
1039076222 8:33692885-33692907 CTGCCTTATCACAAGGACAGAGG + Intergenic
1041162700 8:55061236-55061258 CTGCCTCAGCCCCAGTGCCCTGG + Intergenic
1044085318 8:87936295-87936317 CTGCCTTATCACAAGGACAGAGG + Intergenic
1047210269 8:122834957-122834979 CTGCCTCCGCACCAGTAGGCTGG + Intronic
1048027269 8:130598122-130598144 CTGCCTCTGCATCAGGACCCGGG - Intergenic
1048082952 8:131148741-131148763 CTGCCTTATCTCCAGGACAGGGG + Intergenic
1049265917 8:141667851-141667873 CTTCCTCAGCTCCAGCACGCTGG - Intergenic
1049584044 8:143424873-143424895 CTGCCCCAGCCCCAGCACAAGGG - Intronic
1049657242 8:143804294-143804316 CTGCCTGGGCAGCAGAACACTGG - Intronic
1049674205 8:143882619-143882641 GGGCCTCAGCAGCAGGACACGGG - Intergenic
1051994671 9:23200786-23200808 CTGCCTTCGAACTAGGACACTGG + Intergenic
1054449193 9:65393602-65393624 CTACATCCGCACCAGGGCACAGG + Intergenic
1055749516 9:79489319-79489341 CTGCCCCAGAACCAGGATAATGG - Intergenic
1057396923 9:94688893-94688915 CTGCCTCAGGACCCTGGCACAGG - Intergenic
1057740238 9:97704907-97704929 GTGCCACAGCACCAGCACAGAGG - Intergenic
1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG + Intronic
1061875921 9:133543948-133543970 CTTCCTAAGCACCAGGCCCCAGG - Intronic
1062031558 9:134364296-134364318 CTGCGTGGGCACCAGGGCACTGG + Intronic
1062325318 9:136009983-136010005 CTGCCCCTGGACAAGGACACAGG + Exonic
1062468709 9:136692717-136692739 CTGACACGGCCCCAGGACACAGG - Intergenic
1062698981 9:137889466-137889488 CAGCCCCAGCCCCAGAACACGGG - Intronic
1186561968 X:10622227-10622249 ATGCCCCAGCCACAGGACACAGG + Intronic
1188239342 X:27766074-27766096 CTGCCTTATCACAAGGACAGAGG + Intergenic
1190288237 X:48974519-48974541 CTGCAGCAGCACCATGCCACAGG - Intronic
1191766571 X:64705015-64705037 CTGCCTTATCACAAGGACAGAGG + Intergenic
1192359873 X:70432703-70432725 CAGCCTCATCACCAGGGCCCTGG - Intronic
1196081519 X:111637768-111637790 GTGCCTCAGGAACAGGACCCAGG - Intergenic
1197511301 X:127372145-127372167 CTGCCTTAGTAGCAGAACACAGG + Intergenic
1198167540 X:134072256-134072278 CTGCCTTATCACAAGGACAGAGG + Intergenic
1198691784 X:139292738-139292760 CTGCCTGAGAACCAGTACCCTGG + Intergenic
1199543289 X:148981395-148981417 CAGCTTCAGCACCAGGTCAACGG - Intronic
1200073515 X:153540323-153540345 CTCCCTCAGCACCGTGACTCCGG + Intronic
1202585353 Y:26418638-26418660 CTGCCTCACCACAAGAACTCTGG - Intergenic