ID: 1130239948

View in Genome Browser
Species Human (GRCh38)
Location 15:82178749-82178771
Sequence GAGGGGCATGTCCAGAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130239948_1130239955 25 Left 1130239948 15:82178749-82178771 CCAATTCTCTGGACATGCCCCTC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1130239955 15:82178797-82178819 TCTATACTGAAGCTAATCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130239948 Original CRISPR GAGGGGCATGTCCAGAGAAT TGG (reversed) Intronic
903448706 1:23438249-23438271 GAGGGGGCTGTCCAGAAGATGGG - Intronic
911059915 1:93738898-93738920 GAGAGCCAGGGCCAGAGAATAGG + Intronic
911388623 1:97210008-97210030 GTGGGGCATGACCATAGAATAGG + Intronic
916733517 1:167587144-167587166 GAGGGACATTTCCAGGGCATGGG - Intergenic
917191817 1:172426132-172426154 GAAGTGCATATCCAGAGAATAGG - Intronic
917214544 1:172664566-172664588 GAGGGCCTTGCCCAGAGAATAGG - Intronic
920390407 1:205596774-205596796 GAGGGGCTTGCGCAGAGAGTTGG + Intronic
920500366 1:206481468-206481490 GAGGAGCATCTCCAGATAACAGG + Intronic
921945661 1:220884379-220884401 GGGGGCCATGTCCAGGGACTCGG - Exonic
924875749 1:248102285-248102307 GAGGGTCTTGTTCAGAGACTGGG - Intergenic
1063347975 10:5328814-5328836 GAGGTGCATGTGCAGAGGAAAGG + Intergenic
1068885369 10:62092037-62092059 CAGGGACATGTACAGGGAATCGG + Exonic
1070637366 10:78140045-78140067 GAGGGGCATGGCCAGAGGCTGGG + Intergenic
1070930326 10:80256431-80256453 GAGGGAGATGTCCAGAGAGCTGG + Intergenic
1071301188 10:84257259-84257281 GAGGGGCTTGTCCAGAGAGCGGG - Intronic
1078444349 11:11393054-11393076 GCAGGGCATGTCCAGACAATGGG + Intronic
1081786255 11:45749954-45749976 GTGGGGCAGGACCTGAGAATAGG - Intergenic
1082716902 11:56625290-56625312 GAGGAGAGTGTCAAGAGAATTGG + Intergenic
1086728185 11:90216391-90216413 AAGGGGCATATTCAGAGAAAAGG - Intronic
1090745947 11:129704911-129704933 GAGAGGCAGGTGCAGAGGATGGG + Intergenic
1093438896 12:19170156-19170178 GAGAGGCATTTCCAGATACTGGG - Intronic
1096073646 12:48789153-48789175 GAGGGGGATGCCCAGACAAAAGG - Intergenic
1100700028 12:97137610-97137632 TAGGGGTAAGTCCAGAGAAAAGG + Intergenic
1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG + Intergenic
1103713427 12:122929469-122929491 CTGGGGGATGTCCAGAGACTAGG - Exonic
1107868913 13:44729403-44729425 GAGGCGCATGTCCGGACTATCGG + Intergenic
1109189833 13:59310714-59310736 GATGTGCATGTCAAGTGAATTGG - Intergenic
1113068350 13:106393941-106393963 GAGGAGCATGTGCAGAGAGGTGG - Intergenic
1116410282 14:44613010-44613032 GAAGGAAATGCCCAGAGAATTGG - Intergenic
1117274653 14:54180389-54180411 TAGGAGCATGGCCAGAGAAAGGG + Intergenic
1118697190 14:68396808-68396830 GAATGGGATGTCCAGAAAATTGG + Intronic
1121027080 14:90624479-90624501 GAGGTGCATGTCCAGTGGTTGGG - Intronic
1124119528 15:26876804-26876826 GATGGGCATGGCAAGAGAATGGG + Intronic
1125427935 15:39568288-39568310 GATGTGCATGTACAGAGAAAAGG - Intergenic
1128326284 15:66726122-66726144 GGGGGGCAGGTGCAGAGAAGGGG - Intronic
1129349121 15:74944079-74944101 GAGGAGCATCTCCAGTGAACAGG + Intergenic
1129942423 15:79510004-79510026 GAGGGGCAGATCCAGAGGATAGG - Intergenic
1130239948 15:82178749-82178771 GAGGGGCATGTCCAGAGAATTGG - Intronic
1131422959 15:92322495-92322517 GTGGGCCATGTCTAGAGAAAAGG - Intergenic
1132986299 16:2769323-2769345 GAGTGACTTGTCCAGAGAAGGGG + Intronic
1134691644 16:16194599-16194621 GTGGGGCTTGTCAAGAGAATGGG - Intronic
1134747172 16:16597299-16597321 GAGGGGGTTCTCCAGAGAAAGGG + Intergenic
1135985984 16:27184644-27184666 GAGGGAGATGTCCTGAGACTGGG + Intergenic
1138687613 16:58739244-58739266 AAGGGGCAGGTCCACAGAAAAGG - Intergenic
1139693545 16:68656789-68656811 CAGGGGCCTGTGGAGAGAATAGG - Intronic
1143376388 17:6470081-6470103 GAGTGACATGACCAGAGAATGGG - Intronic
1147374584 17:40016144-40016166 GAGGGGAAAGACCAGAGAGTCGG + Intronic
1148093236 17:45035093-45035115 GAGGGACATGTCCTGAGCTTGGG + Intronic
1149755655 17:59183299-59183321 AATGGGCATGTACAGAGAAGAGG - Intronic
1150346924 17:64411606-64411628 GATGGGCATGTGCAGTGGATGGG + Intronic
1151429037 17:74050215-74050237 GCGGGGGATGTCCAGAGAGGAGG - Intergenic
1152375444 17:79916287-79916309 GAGGGGCTGGTCCAGAGGCTGGG + Intergenic
1160012983 18:75120558-75120580 GAGGGGCGTGGCCAGAGAGTGGG + Intergenic
1161793935 19:6375853-6375875 GACGGGCAGGTCCTGAGAGTGGG + Intronic
1161856628 19:6769435-6769457 TAGGGGCATGTTCAGGGAAGGGG + Intergenic
1161860303 19:6792887-6792909 GAGGGGCCTGTCCTGGGCATTGG - Intronic
1163519592 19:17784056-17784078 GGAGGGCATGTCCCGAGGATTGG + Intronic
1164044171 19:21520302-21520324 CAGGGACATGTCCAGAGACTTGG + Intronic
1164184893 19:22856716-22856738 GAGGGGCTTTTCCAGACACTTGG - Intergenic
1164523736 19:28998480-28998502 GCGGGGCATGTTCAGAAATTTGG + Intergenic
1166087824 19:40488479-40488501 GAGGGGCATGGCTATGGAATAGG + Intronic
1167407825 19:49325214-49325236 GCGGCGCATGCGCAGAGAATCGG - Exonic
1168696532 19:58407021-58407043 GCGGGGCATGGCCAGAAAACTGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
930695733 2:54410100-54410122 GCTGTGCACGTCCAGAGAATGGG + Intergenic
932122558 2:69115066-69115088 GAGGGGCCTGTCCTGTGCATTGG + Intronic
932335951 2:70931541-70931563 GAGGGGCATGACCAGAGGAGGGG - Intronic
932626531 2:73300864-73300886 GAGGGCCAGGCCCAGAGAAGAGG + Intergenic
932772582 2:74508668-74508690 GAGGGGAATGACCAGAGGACAGG + Intergenic
935311106 2:101784377-101784399 GTGGGGCATGTCCTGAGCACTGG + Intronic
935788785 2:106571833-106571855 GAGGTGCATGGCCAGAAAACTGG + Intergenic
936063276 2:109311667-109311689 GAAAGGCATGTCCACAGACTGGG - Intronic
937971032 2:127549687-127549709 GAGGGACATGTCCAGGGAGAGGG + Intronic
939012711 2:136865180-136865202 TGGAGGCATGTCCAGAGAAAGGG + Intronic
939452241 2:142388884-142388906 GAGGGTAATGTCCAGGGAGTTGG + Intergenic
939845507 2:147241366-147241388 GAGGGGAAGGTTCAGAGAAACGG + Intergenic
940001385 2:148969717-148969739 TGGGGGCTTCTCCAGAGAATTGG + Intronic
945946664 2:216001740-216001762 AAGGGGCAGGCCCAGAGAACGGG - Intronic
947083922 2:226429587-226429609 GAGGGACATGTGAAGAAAATAGG - Intergenic
947436619 2:230078427-230078449 GTGGGGCATTTGCAGAGAAGTGG + Intergenic
947524172 2:230868399-230868421 GAGGGGCATGGCCAGCCAGTGGG - Intronic
948329675 2:237155185-237155207 GATGGGCATGTCAAGAGGCTGGG - Intergenic
1170533400 20:17316197-17316219 GAGAGGCATGTCCTGTGAGTCGG - Intronic
1172075879 20:32297046-32297068 GAGAAGCCTGTCCAGGGAATTGG + Intronic
1172201921 20:33132640-33132662 GACTGGCATTTCCAGAGAAATGG + Intergenic
1173199785 20:40945923-40945945 AAGGGCCATGTTCAGAGACTTGG + Intergenic
1173227351 20:41169653-41169675 CAAGGGGATGTCCAGAGCATGGG - Intronic
1173617659 20:44413581-44413603 GTGGGGGGTGTCCAGAGAACAGG - Intronic
1173768539 20:45636605-45636627 AAGGGGCATGTCTGGAGCATAGG - Intergenic
1173952911 20:47007402-47007424 GAGGGGCAGGCCCTGGGAATGGG + Intronic
1174314312 20:49685687-49685709 AAGAGGCATATCCAGACAATAGG + Intronic
1174459688 20:50673543-50673565 GAGGGTCATTTCCAGAGACTGGG - Intronic
1174788286 20:53453796-53453818 GAGAGGGATGCCCAGAGAAATGG + Intronic
1176510772 21:7745755-7745777 GAGGGGTAGGTCCAGAGAGGGGG - Intronic
1178644885 21:34376284-34376306 GAGGGGTAGGTCCAGAGAGGGGG - Intronic
1178711789 21:34923761-34923783 GAGGGACATAACCAGAGGATGGG - Intronic
1179995217 21:44971062-44971084 GAGGTGGAGGTCCAGAGCATGGG - Intronic
954686294 3:52372049-52372071 GAGCAGCATGTCCAGTAAATGGG - Exonic
957607327 3:82418228-82418250 GAGAGGCATGGCCATAGGATTGG + Intergenic
958999824 3:100950532-100950554 GAAGGACTTGTCCAGAGAACAGG + Intronic
961157907 3:124696394-124696416 GTGGTGCATGTCCAGCTAATCGG - Intronic
961178075 3:124852347-124852369 CAGGGGCAGGACCAGAGAAATGG + Intronic
961347632 3:126274391-126274413 GAGGGGCAGGTCCAGGGAAATGG - Intergenic
962296411 3:134192699-134192721 GAATGGCATCTCCAGATAATGGG + Intronic
962489056 3:135873098-135873120 GAGGGGCCTCCCCAGAGAACTGG + Intergenic
965014768 3:163142833-163142855 GAAGGGAATGTACAGAGAAAGGG + Intergenic
965806592 3:172548476-172548498 CAAGGGCATGTACAGAAAATAGG + Intergenic
968628117 4:1637201-1637223 GGCGGGGATGGCCAGAGAATAGG + Intronic
969330700 4:6472242-6472264 GCGGGGCATGCCCAGAGCACCGG - Intronic
972228951 4:37048125-37048147 GATGAGCATGTTCAGAGTATTGG - Intergenic
972286477 4:37653531-37653553 TAAGGACATGTCCAGAGAAAAGG - Intronic
973268015 4:48230768-48230790 GAGGGGAATCTCCGGAGATTTGG - Intronic
975416504 4:74111434-74111456 AAGGAGGATGTTCAGAGAATTGG - Intergenic
975997093 4:80328383-80328405 GAGGATGATATCCAGAGAATTGG + Intronic
976463507 4:85341097-85341119 GAAGGACATGTCCAAACAATAGG - Intergenic
982682910 4:158453418-158453440 GAGGGGCATATACACAGAACTGG + Intronic
984841982 4:184077302-184077324 GGGGCGCAGGTCCAGAGAAAAGG - Intergenic
986499801 5:8386901-8386923 GATGGTCTTGTTCAGAGAATTGG + Intergenic
988819045 5:34862671-34862693 GTGGGGAATCTCTAGAGAATTGG - Intronic
990895663 5:60698251-60698273 GAGGTGCATGTGGAGAGGATGGG - Intronic
991392651 5:66164660-66164682 GAGGAGGATGTACAGAGAGTAGG + Intronic
991641717 5:68760897-68760919 GATGGTGATGTTCAGAGAATGGG - Intergenic
994591790 5:101783398-101783420 GAGGGACATCTCCAGGGACTCGG - Intergenic
995064986 5:107851494-107851516 GAGTGGCATATCCACACAATGGG + Intergenic
995629323 5:114116225-114116247 GAGGGTCATTGCCAGAGGATGGG + Intergenic
996126751 5:119734602-119734624 GAGAGGCTTTTCCAGGGAATTGG - Intergenic
997881729 5:137597972-137597994 GAGTGGCATGCACAGAGAAAGGG + Intronic
1001883894 5:175270993-175271015 GAGGGGCATGTGAAGGGAAGAGG + Intergenic
1002526705 5:179819334-179819356 TAGGGGCATGTGAAGAGACTGGG - Intronic
1005776803 6:29142213-29142235 CAGGGAAATGTCCAGAGAAATGG - Intergenic
1006471801 6:34233866-34233888 AATGGGAATGTCCAGGGAATGGG - Intergenic
1008621897 6:53278992-53279014 GAAGGGCATGTTTGGAGAATGGG - Intronic
1011129968 6:84042630-84042652 GAGGGGCCTGGCCAGAAAAGAGG - Intronic
1020045657 7:5038261-5038283 AATGGGCATGTACAGAGAAGAGG - Intronic
1020291058 7:6722460-6722482 AATGGGCATGTACAGAGAAGAGG - Intergenic
1021213946 7:17892407-17892429 GAGTGGCATATACAGAGAATAGG - Intronic
1023962467 7:44938353-44938375 CTGGGGCATGTCCACAGAAATGG + Intergenic
1026748123 7:73028385-73028407 AACGGGCATGTACAGAGAAGAGG - Intergenic
1026751771 7:73056530-73056552 AACGGGCATGTACAGAGAAGAGG - Intergenic
1026755420 7:73084657-73084679 AACGGGCATGTACAGAGAAGAGG - Intergenic
1026759070 7:73112671-73112693 AACGGGCATGTACAGAGAAGAGG - Intergenic
1027034326 7:74913699-74913721 AACGGGCATGTACAGAGAAGAGG - Intergenic
1027088338 7:75280802-75280824 AACGGGCATGTACAGAGAAGAGG + Intergenic
1027091980 7:75308730-75308752 AACGGGCATGTACAGAGAAGAGG + Intergenic
1027095623 7:75336697-75336719 AACGGGCATGTACAGAGAAGAGG + Intergenic
1027323718 7:77030989-77031011 AACGGGCATGTACAGAGAAGAGG - Intergenic
1028455954 7:91038541-91038563 CAGGGGCTTGTCCTGAGAAAAGG + Intronic
1029395728 7:100307421-100307443 AACGGGCATGTACAGAGAAGAGG + Intergenic
1033546558 7:142406404-142406426 GAGATGCATGTCCAGAGAGCTGG - Intergenic
1034952408 7:155308084-155308106 GTGGGACATGTGCAGAGAACTGG - Intronic
1034989534 7:155539280-155539302 GTGGGTCATGTCCAAAAAATTGG - Intergenic
1035045392 7:155962306-155962328 GAGGGACAGGTCCAGGGAGTTGG - Intergenic
1035050221 7:155994436-155994458 GAGGGGCAGGACCAGAGATGGGG - Intergenic
1035662517 8:1358877-1358899 GAGGGTGAGGTCCAGAGACTCGG + Intergenic
1037898031 8:22671190-22671212 GAGGGGCAAGCCCAGAGAAGTGG + Intergenic
1039386002 8:37136009-37136031 CAAGGGCTTGGCCAGAGAATGGG + Intergenic
1039394860 8:37216892-37216914 GAGGGGCCAGTGCAGAGAAGTGG + Intergenic
1041668777 8:60471822-60471844 GAGGGTCATGCCCTGATAATGGG + Intergenic
1043166313 8:76907362-76907384 GAGGGGCATTTTCATAGAGTAGG - Intergenic
1044659232 8:94579016-94579038 GAGGGGCATGTCCTGTGATATGG + Intergenic
1047290332 8:123524242-123524264 GGGGGACATGGCCACAGAATTGG - Intronic
1047343060 8:124001211-124001233 GGAGGGCAGGGCCAGAGAATAGG - Intronic
1048461229 8:134623364-134623386 GAGGGGCATGAGTAGAGACTGGG - Intronic
1049223432 8:141438259-141438281 GAGGACCAGGTCCAGAGAAGAGG - Intergenic
1049415530 8:142493202-142493224 GAGGGGCCTGTCCAGTGAGCCGG + Intronic
1049837101 8:144743393-144743415 CAGTGGCACATCCAGAGAATGGG - Intronic
1050137577 9:2483158-2483180 GAAGGGCATGTGCAGGGTATAGG + Intergenic
1051105968 9:13580890-13580912 GAGGGGCATGGCTGGAGAAAGGG - Intergenic
1052274136 9:26658829-26658851 GAGGGGCATGTCAGGAGCCTTGG + Intergenic
1053053086 9:34977451-34977473 GATGAGCATGTCCAGAGCCTTGG + Intronic
1057205675 9:93171053-93171075 GAGGGGCATGTCCCGTGACTGGG + Intergenic
1057297412 9:93857427-93857449 TGGGGGCATGGCCAGGGAATGGG - Intergenic
1058429661 9:104906992-104907014 GAGAGGCATGTTCAGATATTTGG - Intronic
1062541392 9:137043196-137043218 GAAGGGCATGTCCAGAACAATGG - Intronic
1189845186 X:45129427-45129449 GAGGAGCATGTACATAGTATTGG + Intergenic
1196609372 X:117694473-117694495 GAGGGGAATGAACAGGGAATGGG - Intergenic
1199594538 X:149496098-149496120 GAAGGGAATGTCCAGAGAGTTGG - Intronic
1199746467 X:150774895-150774917 GAGTGGCATGAGCAGGGAATGGG - Intronic
1200849311 Y:7866339-7866361 GAGAGCCATGTCCAGGGAAGGGG + Intergenic