ID: 1130242271

View in Genome Browser
Species Human (GRCh38)
Location 15:82205720-82205742
Sequence AGGAATATACTCTTTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130242269_1130242271 12 Left 1130242269 15:82205685-82205707 CCTCTACATTGTTAAATGTCATT 0: 1
1: 0
2: 1
3: 20
4: 297
Right 1130242271 15:82205720-82205742 AGGAATATACTCTTTGAAGATGG 0: 1
1: 1
2: 3
3: 31
4: 377
1130242268_1130242271 25 Left 1130242268 15:82205672-82205694 CCTAATTATCTGGCCTCTACATT 0: 1
1: 1
2: 0
3: 15
4: 191
Right 1130242271 15:82205720-82205742 AGGAATATACTCTTTGAAGATGG 0: 1
1: 1
2: 3
3: 31
4: 377
1130242267_1130242271 26 Left 1130242267 15:82205671-82205693 CCCTAATTATCTGGCCTCTACAT 0: 1
1: 1
2: 0
3: 11
4: 151
Right 1130242271 15:82205720-82205742 AGGAATATACTCTTTGAAGATGG 0: 1
1: 1
2: 3
3: 31
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130242271 Original CRISPR AGGAATATACTCTTTGAAGA TGG Intronic
900753048 1:4411854-4411876 AGGAACGTACACTTGGAAGAAGG + Intergenic
900943956 1:5819107-5819129 AGGAACGTACACTTGGAAGAAGG - Intergenic
901748532 1:11390864-11390886 AGGAAAAGACTCTTTAAAAAAGG - Intergenic
903760616 1:25695633-25695655 TGGCAAAAACTCTTTGAAGAAGG - Intronic
904250497 1:29220501-29220523 AGGAAAATACTCCTGCAAGATGG + Intronic
904411392 1:30327031-30327053 TGGACTATACTCTGTGAAAATGG - Intergenic
904494794 1:30880509-30880531 AAGAATGTACTCTTGGAAGCAGG - Intronic
908569812 1:65397474-65397496 AGGAATATATTTTTTCAAAAAGG - Intronic
908586097 1:65571179-65571201 AAGAATATACGTTTTAAAGATGG + Intronic
908730198 1:67218574-67218596 TGGAATATACTCTTTTAATGGGG - Intronic
909444445 1:75732744-75732766 AGGTATATACATTTTAAAGAGGG + Intronic
910350586 1:86292757-86292779 AGGAAAGTACTCTCTGTAGAGGG + Intergenic
911189048 1:94929578-94929600 AGTAATGTACACTTGGAAGAGGG + Intergenic
911265275 1:95735672-95735694 AAGAGTTTACTCTTTGAACAAGG + Intergenic
911337363 1:96596805-96596827 AGGAATATGCATTTTTAAGAAGG + Intergenic
911686668 1:100785389-100785411 AAGAATTTTCTATTTGAAGAAGG - Intergenic
911859237 1:102926639-102926661 AGAAATGTGCTCTTTGATGAGGG - Intronic
912282736 1:108333751-108333773 AGGAGTATAACCTTTGAAAAAGG - Intergenic
912407163 1:109449787-109449809 AGAAATATAATCTTTGACAAAGG + Intergenic
912549607 1:110476537-110476559 AGGAAAGTACTCTTGGAAGAGGG + Intergenic
912964276 1:114223926-114223948 AGGAAAATTACCTTTGAAGATGG - Intergenic
913008370 1:114657523-114657545 AGGAAGAGACTCTATCAAGAAGG + Intronic
913650236 1:120906708-120906730 ATGAATATTCTCTCTGAAGCTGG + Intergenic
914076437 1:144356787-144356809 ATGAATATTCTCTCTGAAGCTGG - Intergenic
914102741 1:144609710-144609732 ATGAATATTCTCTCTGAAGCTGG + Intergenic
914170884 1:145222367-145222389 ATGAATATTCTCTCTGAAGCTGG - Intergenic
914525998 1:148466335-148466357 ATGAATATTCTCTCTGAAGCTGG - Intergenic
914640404 1:149600788-149600810 ATGAATATTCTCTCTGAAGCTGG + Intergenic
914835800 1:151205890-151205912 AAGAATATACTCTTTCCTGATGG + Intronic
915976803 1:160396540-160396562 AAGAATCTACTCTTTTAAGAAGG + Intergenic
916503515 1:165407404-165407426 GGGAAAATAGTCTTTCAAGAAGG - Intronic
916896443 1:169168213-169168235 AGGAAAGTACACTTGGAAGAGGG - Intronic
916965555 1:169938768-169938790 AGGAAAAGATTCTCTGAAGAAGG + Intronic
917216042 1:172679177-172679199 AGCAAAATACACTTGGAAGAGGG + Intergenic
917337981 1:173945034-173945056 TGGAACATATTCTTTGAATATGG - Intronic
917766947 1:178230731-178230753 AGTAAAATACACTTGGAAGAGGG + Intronic
918270458 1:182893409-182893431 AGGAAAGTACACTTGGAAGAGGG + Intergenic
918575254 1:186050992-186051014 AGGCATTAACTCTGTGAAGAGGG + Intronic
918705977 1:187662723-187662745 AAGAATATTCTCTGTGAACAAGG - Intergenic
919167723 1:193917110-193917132 ATGAATATTCTCTTTAAAGCAGG - Intergenic
919721975 1:200847314-200847336 AGGAAAATACTCTTTTAAGTAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920879113 1:209863896-209863918 AGGAAAGTACGCTTGGAAGAGGG + Intergenic
921661897 1:217812907-217812929 AGAAAGAGACTCTTTCAAGATGG + Intronic
921967416 1:221105249-221105271 AGGAATTAACTAGTTGAAGAGGG + Intergenic
922033024 1:221822653-221822675 AGGAAGAAACTCATTGATGATGG + Intergenic
922663502 1:227449851-227449873 AGGAAAGTACACTTGGAAGAGGG + Intergenic
922873985 1:228925588-228925610 AGTAAAATACACTTGGAAGAGGG - Intergenic
923790767 1:237109314-237109336 AGAAATATAATCTTAGAAGATGG + Intronic
924266599 1:242288843-242288865 AGGAATATATTACTAGAAGAAGG - Intronic
924798080 1:247307403-247307425 ATCAATATACTTTTAGAAGATGG - Intronic
1063141738 10:3261929-3261951 TGGAATATTTTCTTAGAAGAAGG + Intergenic
1063577744 10:7276969-7276991 AGAAATCTATCCTTTGAAGATGG - Exonic
1065143123 10:22738898-22738920 GTGAATATAAACTTTGAAGATGG - Intergenic
1065940450 10:30559526-30559548 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1066718233 10:38309714-38309736 AGGAATATATTACTAGAAGAAGG + Intergenic
1067316340 10:45168029-45168051 AGGAAATTATTCATTGAAGAAGG + Intergenic
1068191995 10:53664721-53664743 AGTAAAATACACTTGGAAGAGGG + Intergenic
1068243925 10:54340647-54340669 AGCAAAATACTCTTGGAAGACGG + Intronic
1068412121 10:56669587-56669609 AGGAATAAACTTGGTGAAGAAGG + Intergenic
1068427539 10:56887095-56887117 ACCAATATTCTCTTAGAAGAAGG + Intergenic
1072382060 10:94882982-94883004 AGGTATATTCTCTGTGAAGGTGG - Intergenic
1072797361 10:98366125-98366147 AGAAATATGCCCTATGAAGAAGG - Intergenic
1072923992 10:99600180-99600202 TGGAATATACTGTTTAAAGGAGG + Intergenic
1073748727 10:106499669-106499691 AGCAAAATACACTTGGAAGAGGG - Intergenic
1075240248 10:120771878-120771900 AGGAAAATACACTTGCAAGAGGG - Intergenic
1075625138 10:123958581-123958603 ATGAGTATACTCTGTGAAGCTGG - Intergenic
1076336591 10:129710562-129710584 TGGATTTTACTGTTTGAAGAAGG + Intronic
1077882260 11:6360415-6360437 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1078524496 11:12090245-12090267 AGGAACTTCCTCTTTGAAGCAGG - Intergenic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1080808106 11:35674903-35674925 AGGAATAGATTCTTAGAGGAAGG + Intronic
1081303273 11:41479577-41479599 AGAAATTTATTCTCTGAAGATGG - Intergenic
1083041165 11:59688754-59688776 AGGAAATTACACTTGGAAGAGGG + Intergenic
1085175275 11:74481041-74481063 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1087940987 11:104096831-104096853 AGTTTTATACCCTTTGAAGAAGG - Intronic
1088353461 11:108916191-108916213 AGGAATGTACTATCTGAAGGTGG - Intronic
1089649642 11:119904399-119904421 AGGAAGCCACTCTTTGAAGAAGG + Intergenic
1091336750 11:134775510-134775532 AGGCCTATTCTGTTTGAAGATGG + Intergenic
1091844715 12:3647034-3647056 AGGAACATGCACTTTGAAGCTGG - Intronic
1093807956 12:23457777-23457799 AGGTATCTTCTCATTGAAGATGG - Intergenic
1093887795 12:24482593-24482615 ATAAATATACTATTTGTAGAAGG - Intergenic
1097344014 12:58471150-58471172 AGAAATAAACTTTCTGAAGATGG - Intergenic
1100205977 12:92350165-92350187 ACAATGATACTCTTTGAAGATGG - Intergenic
1100291937 12:93223994-93224016 AGGAAAATACACTTGGAAGAAGG + Intergenic
1100723959 12:97388605-97388627 AGGAAGAGACTCTTATAAGAAGG - Intergenic
1101407246 12:104439355-104439377 AGGAAAATACATTTGGAAGAGGG - Intergenic
1102466500 12:113133697-113133719 AGGAAGAGCCCCTTTGAAGAAGG + Intronic
1103161525 12:118733251-118733273 AGGAAGGTACACTTGGAAGAGGG - Intergenic
1104583811 12:130030936-130030958 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1106556715 13:30816022-30816044 AGGAATATACTCTAAGGACAGGG - Intergenic
1107028602 13:35828602-35828624 AGGAAAGTACACTTGGAAGAGGG - Intronic
1107310026 13:39066877-39066899 AGGAATAAACTCAATAAAGAAGG - Intergenic
1108156229 13:47587873-47587895 CTAAATATACTCTTTCAAGATGG + Intergenic
1108702148 13:52952915-52952937 AGGAAAGTACACTTGGAAGAAGG + Intergenic
1108749376 13:53431723-53431745 AGGAATAGAATTTTTGAAGGGGG - Intergenic
1109007278 13:56894061-56894083 AGGAAGGTACACTTGGAAGAGGG + Intergenic
1109844163 13:67962413-67962435 AGGAATATGGTATTTGAACAGGG + Intergenic
1110163257 13:72405350-72405372 TTGAATTTTCTCTTTGAAGATGG + Intergenic
1110409305 13:75186432-75186454 AGTAAAGTACTCTTGGAAGAGGG + Intergenic
1113704313 13:112416091-112416113 AGGAAAAGACACATTGAAGAAGG - Intronic
1114058332 14:18995840-18995862 AGGAATATGCTCAATGAAAAAGG - Intronic
1114104214 14:19405914-19405936 AGGAATATGCTCAATGAAAAAGG + Intronic
1114790925 14:25657461-25657483 AGGAAAGTACACTTGGAAGAAGG - Intergenic
1114793279 14:25683032-25683054 ATGTATATACCCTTTAAAGAAGG + Intergenic
1114797289 14:25730659-25730681 AGGAATATAATCTTAGAAATCGG + Intergenic
1116106826 14:40518949-40518971 AAGAATATTCTATTTGAAAATGG + Intergenic
1116990272 14:51268630-51268652 AGGAGTATATACTTTGATGAGGG + Intergenic
1117178429 14:53168795-53168817 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1118385158 14:65250201-65250223 TGGAATAGACACTTTGAATATGG - Intergenic
1118981188 14:70718387-70718409 AGGATAATACTCTTTCAAGCAGG + Intergenic
1119184574 14:72630856-72630878 AGGATTATATGCTTTAAAGAAGG + Intronic
1119597121 14:75945141-75945163 AGGAAAGTACACTTGGAAGAGGG - Intronic
1120194044 14:81463816-81463838 AGGAAAATGCTTTGTGAAGATGG - Intergenic
1120267882 14:82274650-82274672 AGGAAACTACACTTGGAAGAGGG + Intergenic
1121132578 14:91461831-91461853 AGGAATATACTATTTCAGGAAGG - Intronic
1121163183 14:91764796-91764818 AGGAATATATTATTTAATGAAGG + Intronic
1121261827 14:92572051-92572073 AGGAAAGTACACTTGGAAGAGGG + Intronic
1121981416 14:98457679-98457701 AGGACTCTTCTCTTTGAAGTGGG - Intergenic
1122385062 14:101339124-101339146 AGGAACAGGCACTTTGAAGAAGG + Intergenic
1123497127 15:20838558-20838580 AGGAATATACTTAATGAAGGAGG + Intronic
1123554361 15:21412192-21412214 AGGAATATACTTAATGAAGGAGG + Intronic
1123590606 15:21849513-21849535 AGGAATATACTTAATGAAGGAGG + Intergenic
1126191174 15:45880544-45880566 TGGAATATAATCTGTCAAGAGGG - Intergenic
1126923972 15:53561432-53561454 AGGAATACCCTCTTTGCTGACGG - Intronic
1127913328 15:63436119-63436141 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1129641277 15:77381061-77381083 TGGGATATTCTCTGTGAAGAGGG - Intronic
1130242271 15:82205720-82205742 AGGAATATACTCTTTGAAGATGG + Intronic
1130458109 15:84135098-84135120 AGGAATGTACTCTTTGAAGATGG - Intergenic
1202962708 15_KI270727v1_random:139390-139412 AGGAATATACTTAATGAAGGAGG + Intergenic
1133360230 16:5168253-5168275 AGGAATAGGGTCTTTGCAGATGG + Intergenic
1134876239 16:17701423-17701445 AGGAAAATGCTCTCAGAAGAAGG + Intergenic
1135528580 16:23232990-23233012 AGGAAGGTACACTTGGAAGAGGG + Intergenic
1136734954 16:32458562-32458584 AGAAATGTACTCAGTGAAGAGGG + Intergenic
1137906098 16:52323472-52323494 AGGTGGATACTCTTTGCAGATGG - Intergenic
1138639536 16:58372988-58373010 ATGAATATACTCTTTGATGCAGG - Intronic
1138815632 16:60200053-60200075 AGGAAAGTACACTTGGAAGAAGG + Intergenic
1139074427 16:63426645-63426667 AGTAAAATACACTTGGAAGAGGG + Intergenic
1139099651 16:63750062-63750084 AGTAAAATACACTTGGAAGAGGG + Intergenic
1140459706 16:75129918-75129940 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1203018123 16_KI270728v1_random:371030-371052 AGAAATGTACTCAGTGAAGAGGG - Intergenic
1203036458 16_KI270728v1_random:644188-644210 AGAAATGTACTCAGTGAAGAGGG - Intergenic
1203115244 16_KI270728v1_random:1483454-1483476 AGGAAAATATACTTGGAAGAGGG + Intergenic
1144529556 17:16023736-16023758 ATAAATATACTCTTTGAGGCTGG - Intronic
1149304189 17:55332731-55332753 AGTAAGATACACTTGGAAGAGGG + Intergenic
1149500758 17:57150600-57150622 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1149824298 17:59813185-59813207 GGAAATATATTCTTTGAAGTAGG - Intronic
1150670650 17:67193966-67193988 AGGAATATACTTTGTGTAAAAGG - Exonic
1150827972 17:68493334-68493356 AGGAAAATACACTTGGAAGAGGG + Intergenic
1153153428 18:2122041-2122063 AGAAGAATACTCTTTAAAGAAGG - Intergenic
1153171123 18:2317144-2317166 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1153398721 18:4656776-4656798 GAGTGTATACTCTTTGAAGATGG - Intergenic
1153818802 18:8814581-8814603 TGGCATATATTCTTTGAAAATGG + Intronic
1154455146 18:14514980-14515002 AGGAATATACTTAATGAAGGAGG + Intronic
1156388964 18:36632911-36632933 AGTAAAATACACTTGGAAGAGGG + Intronic
1156858190 18:41807113-41807135 AGAAATATATTTTTGGAAGATGG - Intergenic
1157107987 18:44792693-44792715 AGGAATATGCTTTTTGATGTTGG + Intronic
1157458604 18:47862513-47862535 AGGAATGTGCTATATGAAGATGG - Intronic
1157707599 18:49820612-49820634 AGGAAAGTACACTTGGAAGAGGG - Intronic
1158256759 18:55559460-55559482 ATGAATATATTCTTTAAAAAAGG + Intronic
1159054637 18:63451689-63451711 AGTAAAATACACTTGGAAGAGGG + Intergenic
1159472047 18:68869359-68869381 AGGAAGAGAGTCTTTGAACAAGG + Intronic
1160424374 18:78770168-78770190 AGGAATATTTTGTTGGAAGAGGG + Intergenic
1161644403 19:5444274-5444296 AAGAATTTGCTCTTTGAAAAAGG + Intergenic
1164086964 19:21911805-21911827 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1164087129 19:21913101-21913123 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1164126654 19:22324566-22324588 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1164172687 19:22739181-22739203 AGGAAAGTACACTTAGAAGAGGG - Intergenic
1164465644 19:28485353-28485375 AGTAACATACACTTGGAAGAGGG + Intergenic
1166439802 19:42803190-42803212 TGAAAAATACTCTCTGAAGATGG - Intronic
1166474789 19:43113954-43113976 TGAAAAATACTCTCTGAAGATGG - Intronic
1166488765 19:43239043-43239065 TGAAAAATACTCTCTGAAGATGG - Intronic
1167222914 19:48214721-48214743 AGGAAAGTACACTTGGAAGACGG - Intronic
1167724872 19:51204138-51204160 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1167952064 19:53035858-53035880 AGGAAAGTACACTTGGAAGAGGG - Intergenic
925751905 2:7096648-7096670 AGGAAAGTACACTTGGAAGAGGG + Intergenic
926202066 2:10808473-10808495 AGGAAGGTTTTCTTTGAAGATGG + Intronic
926994606 2:18720922-18720944 GGTAATATATTCTTAGAAGAGGG + Intergenic
926996242 2:18739326-18739348 TGGCCTATACTCTTTGTAGAAGG - Intergenic
927551932 2:24009064-24009086 AGGAAAGTACACTTGGAAGAGGG + Intergenic
927799554 2:26085546-26085568 AGGAAAATACACTTGGAAGAAGG - Intronic
929009205 2:37424433-37424455 AGGAAAGTACACTTGGAAGAGGG + Intergenic
929275399 2:40020038-40020060 AGGAGCATACTTTTTGAAGTTGG + Intergenic
930615925 2:53593346-53593368 TGGATCAAACTCTTTGAAGATGG + Intronic
931049460 2:58394368-58394390 CAGAAAATACACTTTGAAGATGG + Intergenic
931294217 2:60905736-60905758 AGAAAAATACACTTGGAAGAGGG + Intronic
931385191 2:61792171-61792193 AGGAAAGTACACTTGGAAGAGGG - Intergenic
931812887 2:65872303-65872325 AGGTATTCACTATTTGAAGACGG + Intergenic
932611203 2:73201777-73201799 AGGAATTTACAGTCTGAAGAAGG + Intergenic
932772950 2:74511806-74511828 AGAAATATAATCTCTGAAGAGGG - Intergenic
938183919 2:129210888-129210910 TGCAATTTACTTTTTGAAGAAGG - Intergenic
940223518 2:151378471-151378493 AAGAAGATACTCTTTGTAGAAGG - Intronic
940480517 2:154224098-154224120 AGGTATATACTCTTTTATAAAGG - Intronic
941010200 2:160290942-160290964 AGGAAAATACTCGGTGGAGATGG - Intronic
941252760 2:163186720-163186742 AGGAGCATACTATTTGAAAAAGG + Intergenic
941926008 2:170895623-170895645 AGCAATATTCTCTGTGAAGTTGG - Intergenic
943583120 2:189707805-189707827 AGCAATAAACTATTGGAAGATGG + Intronic
943803247 2:192088964-192088986 ATCAATAAACTCTTTGAGGATGG + Intronic
944036472 2:195300467-195300489 ATGAATAAACTCTTGGAGGAAGG + Intergenic
944091577 2:195917523-195917545 AGGAAAGTACACTTGGAAGAGGG - Intronic
945701282 2:213173964-213173986 AAGAATATACATTTTGAAAAGGG - Intergenic
947051258 2:226045764-226045786 AGTAAAATACACTTGGAAGAGGG - Intergenic
947156896 2:227171821-227171843 AGGAAAGTACACTTGGAAGAGGG + Intronic
947401224 2:229733349-229733371 AGGAAAGTACACTTGGAAGAGGG + Intergenic
947441563 2:230126556-230126578 AGGAATGTACTGTTTCAAGGAGG - Intergenic
947599830 2:231439970-231439992 AGGAAAGTACACTTGGAAGAGGG - Intergenic
948306956 2:236955431-236955453 AGGAAAGTACTCTTGGAAGAGGG - Intergenic
948403700 2:237702322-237702344 AGCAAGATACTCTTTGAGGGTGG - Intronic
1171177064 20:23060138-23060160 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1173675170 20:44828154-44828176 AGAAATGTACTGTTTGTAGACGG - Intergenic
1175669226 20:60887543-60887565 AGGAATAGACACTCTAAAGAAGG + Intergenic
1176819020 21:13638299-13638321 AGGAATATACTTAATGAAGGAGG - Intronic
1177024354 21:15903926-15903948 GAAAATATACTCTTTGAAAAGGG + Intergenic
1177339499 21:19781955-19781977 AGGAACACACTAGTTGAAGAAGG + Intergenic
1177607113 21:23395111-23395133 AAGAATATCTTCTTGGAAGAAGG - Intergenic
1177913937 21:27064246-27064268 AGAGATGTACTCCTTGAAGATGG - Intergenic
1179009956 21:37548887-37548909 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1180476820 22:15718459-15718481 AGGAATATGCTCAATGAAAAAGG - Intronic
1185108205 22:48885965-48885987 AGGAATAGGCTATTTGGAGATGG - Intergenic
950733480 3:14983797-14983819 ATGAACAAATTCTTTGAAGAAGG - Intronic
951139489 3:19145234-19145256 TGGAATATACACTTCCAAGATGG - Intergenic
951235332 3:20228889-20228911 AGGATTATCCTCTTTTAACAGGG - Intergenic
951983569 3:28592619-28592641 AGGAAAATACTTTATTAAGAAGG + Intergenic
952004198 3:28823290-28823312 AGGAACAAAATCTTTGGAGATGG + Intergenic
952292297 3:32029256-32029278 AGGAAAGTACACTTGGAAGAGGG - Intronic
952466193 3:33588762-33588784 AGGATTATAATCCATGAAGAGGG + Intronic
953798932 3:46006567-46006589 AGTAAAATACACTTGGAAGAGGG - Intergenic
953844479 3:46416574-46416596 AGGAAAGTACACTTGGAAGAGGG + Intergenic
953935453 3:47037962-47037984 AGAAATACAGTCATTGAAGAGGG - Intronic
954349989 3:50035257-50035279 AGGAAAGTACACTTGGAAGAGGG + Intronic
955548141 3:60053788-60053810 AGGAAAGGACTCTTTGAAGGTGG - Intronic
957932273 3:86896660-86896682 ACGAATATACTCATCGAATATGG + Intergenic
957989192 3:87609032-87609054 AGGAATCTTCTCTTTGAGGTTGG - Intergenic
958543057 3:95505117-95505139 AGGAATATAATTGTTAAAGAAGG - Intergenic
960264160 3:115601528-115601550 AAGAATATATCCATTGAAGATGG - Intergenic
960635281 3:119779188-119779210 AGGAATCTTCTCTTTGAAAGCGG - Intergenic
960858395 3:122126462-122126484 AGGATTATACTGTTTAAAAAAGG + Intergenic
961064119 3:123860079-123860101 AAGTATATACTTTCTGAAGAAGG + Intronic
962454014 3:135548354-135548376 AGGAAAATTCTCTATGAGGAGGG - Intergenic
963315024 3:143749778-143749800 AGGAATATACTCTTGAAACCGGG - Intronic
963553234 3:146751785-146751807 AGAAATATTCTCTTTGAGCACGG - Intergenic
964175438 3:153822050-153822072 AGGAAAGTACACTTGGAAGAAGG - Intergenic
964990444 3:162804409-162804431 ATGAAAATACTGTTTAAAGAAGG + Intergenic
965457889 3:168926846-168926868 AGGGTTTTACTCTTTGAAAATGG + Intergenic
965747847 3:171944154-171944176 AGGAATATTTACTTTGAAAAAGG - Intergenic
966603400 3:181797575-181797597 AGGAATATACACTTTGAGAGTGG + Intergenic
967838429 3:193983979-193984001 AGGAAAACACCCTGTGAAGAAGG + Intergenic
969223377 4:5777158-5777180 ACGAAAATCCTCTTTGGAGAAGG - Intronic
970705645 4:18798638-18798660 TGGAATATTTTCTTTGAGGATGG - Intergenic
971003017 4:22343432-22343454 AGGAGAATACTGTGTGAAGATGG + Intergenic
971615728 4:28788703-28788725 AGTAAGATACACTTGGAAGAGGG + Intergenic
971809946 4:31412200-31412222 AGATATAAACTCTTTAAAGACGG + Intergenic
972017010 4:34260270-34260292 GGGAATTTACTGTTTAAAGAAGG - Intergenic
972682320 4:41318237-41318259 GGGCATAGACTCTGTGAAGATGG + Intergenic
973992868 4:56428083-56428105 TAGAATATACTGTTTGAATATGG + Intronic
975077719 4:70233477-70233499 AGGAAAATAAAATTTGAAGAGGG + Intronic
975774618 4:77771809-77771831 ACTAAAATAGTCTTTGAAGAAGG + Intronic
976979281 4:91206398-91206420 AGGAAAATGTTCTTTGGAGATGG + Intronic
977839102 4:101679836-101679858 AGAAATATACTTTATGAAGAAGG - Intronic
977941200 4:102861236-102861258 AAGAATAGACACATTGAAGAGGG - Intronic
978153735 4:105466650-105466672 AGGAAGGTACACTTGGAAGAGGG + Intronic
978633317 4:110773216-110773238 AGGATTTCACTCTTTGAAGAGGG - Intergenic
978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG + Intergenic
979056143 4:115997573-115997595 AGGAAAGTACACTTGGAAGAGGG + Intergenic
979067899 4:116161951-116161973 AGAAATACACTATTGGAAGAAGG - Intergenic
979505622 4:121492466-121492488 AGGAATACATAGTTTGAAGAAGG + Intergenic
980041803 4:127948457-127948479 AGGAAAGTACACTTGGAAGAGGG - Intronic
980116601 4:128685547-128685569 AGGAAAGTACCCTTGGAAGAGGG + Intergenic
980571554 4:134626857-134626879 AGGAAAGTACACTTGGAAGAGGG + Intergenic
981079622 4:140625987-140626009 TGAAATATGCTTTTTGAAGAAGG - Intronic
981638015 4:146902554-146902576 AGGAATATATTCTGTGAAGAGGG - Intronic
982381044 4:154747762-154747784 AGAAGTATACTATTTTAAGATGG - Intronic
982988855 4:162244953-162244975 AGGGAAATACACTTGGAAGAGGG - Intergenic
983370222 4:166849130-166849152 AGGCATATAGTCTTTCAAGTAGG + Intronic
983418218 4:167484783-167484805 AGTAAAATACACTTGGAAGAGGG + Intergenic
983799592 4:171910072-171910094 AGAAATATACTATTTTAAAAGGG - Intronic
983833698 4:172363649-172363671 ACCAATTAACTCTTTGAAGAAGG + Intronic
984750350 4:183266830-183266852 AGGAATATACTCTATCATTAAGG - Intronic
986125768 5:4881246-4881268 AGAAATATGGTCTTTGCAGATGG - Intergenic
986224324 5:5799209-5799231 AGGAAAGTACACTTGGAAGAGGG - Intergenic
986589204 5:9351323-9351345 AGGAATTTACCCTTTGGAAAAGG - Intronic
986748533 5:10764407-10764429 AGGAAAGTACACTTGGAAGATGG - Intergenic
986972441 5:13352816-13352838 AGGACAATACTTTTTAAAGATGG + Intergenic
986977143 5:13408172-13408194 AGGAAGGTACACTTGGAAGAGGG + Intergenic
987202343 5:15590092-15590114 AGGAAGATATGCTTGGAAGAGGG + Intronic
987873914 5:23655528-23655550 AAGAATATATGCATTGAAGAGGG + Intergenic
987886138 5:23815498-23815520 AGGAAAGTACACTTTGAAGAGGG - Intergenic
988583869 5:32491999-32492021 AGGAAAGTACACTTGGAAGAGGG + Intergenic
989663095 5:43821125-43821147 ATGAAGATACTCTGAGAAGATGG + Intergenic
989999818 5:50879808-50879830 AGGAAAGTACACTTGGAAGAGGG - Intergenic
990594194 5:57296553-57296575 AGTAAAATACACTTGGAAGAGGG - Intergenic
991048229 5:62245170-62245192 AGGAAAATATACTTGGAAGAGGG - Intergenic
991385065 5:66078255-66078277 AGGAATAAAGTCTCTGAAGATGG - Intronic
992308487 5:75468277-75468299 AAGAAAATACCCATTGAAGAGGG + Intronic
993057573 5:83000149-83000171 AGGACTAGACTCTTTGAAGATGG + Intergenic
993235656 5:85306237-85306259 AGTAATGTACTCTTTCTAGAGGG - Intergenic
993486129 5:88488316-88488338 ATGAATACACTCTTGGAACAAGG - Intergenic
993724402 5:91351757-91351779 AGGAAAGTACACTTGGAAGAAGG - Intergenic
994451808 5:99952650-99952672 AGTAAGATACGATTTGAAGAAGG + Intergenic
994527234 5:100921587-100921609 AGGAATATACTTATCCAAGAAGG - Intergenic
994764175 5:103895759-103895781 AGGAATCCAGTCTTTGAGGAGGG - Intergenic
994787706 5:104185971-104185993 AGGAAAGTACACTTGGAAGAGGG - Intergenic
995482841 5:112609989-112610011 AGGAAAGTACACTTGGAAGAGGG - Intergenic
995834006 5:116382548-116382570 AGGTATATTGTCTTTGCAGAAGG - Intronic
996441836 5:123499909-123499931 AGGAATCTACTGTTTGTAAAAGG + Intergenic
997013093 5:129903191-129903213 AGGTATATGATTTTTGAAGAAGG - Intergenic
997436397 5:133878785-133878807 AGGAAAGTACACTTAGAAGAGGG - Intergenic
997743040 5:136274551-136274573 AGGAATATTTTCTTTAAATATGG + Intronic
998646935 5:144072440-144072462 AGCATTCTACTCTTTGAAAAGGG - Intergenic
998964178 5:147520718-147520740 AAGGATTTGCTCTTTGAAGAGGG - Intergenic
999566717 5:152871849-152871871 GGGTATATACTCTTTGGGGAAGG - Intergenic
999924708 5:156362293-156362315 AGGAATATTGGCTTTGAAGAGGG - Intronic
1000070111 5:157732489-157732511 GGGAATTTAATCTTTGAAGAGGG + Intronic
1000766582 5:165299233-165299255 AGTAATGTACACTTTGAAGAAGG + Intergenic
1001061342 5:168492122-168492144 TGGAATATAGTCATTTAAGATGG - Intronic
1001685943 5:173595242-173595264 GGGAAAATACTCTCTGAAGGAGG - Intergenic
1004082131 6:12405103-12405125 ACGTATAAAATCTTTGAAGAGGG + Intergenic
1005748519 6:28862296-28862318 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1007041453 6:38726222-38726244 ATGCCTATACTCTTTGCAGAAGG - Intronic
1008018590 6:46549726-46549748 TTGAATATACTCTGTAAAGAAGG + Intronic
1008216101 6:48791588-48791610 ATGAACATGCTCTTTGAACATGG + Intergenic
1008414101 6:51219276-51219298 AAGAATAAACTCTTTCTAGAAGG - Intergenic
1009297620 6:61973379-61973401 AGGATTACAGTGTTTGAAGAAGG + Intronic
1009616521 6:66015190-66015212 AGGATTGAACTCTTTGATGAGGG + Intergenic
1010903196 6:81453204-81453226 ACTGATATACTCTTTGAAGAAGG + Intergenic
1011068001 6:83349920-83349942 AAGAATATACTATTCTAAGAAGG - Intronic
1011973766 6:93264933-93264955 AGGAATATAATCATTCAATAAGG - Intronic
1013416032 6:109925417-109925439 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1013547716 6:111175458-111175480 TTTAATATACACTTTGAAGAAGG + Intronic
1013617679 6:111859969-111859991 AGGAAAATACCCTGTGAAGATGG + Intronic
1014915757 6:127145746-127145768 AGGAAAATATTGTTTGAAAAAGG + Intronic
1016193967 6:141309030-141309052 AGCAAAATACACGTTGAAGAGGG + Intergenic
1017507899 6:155085262-155085284 AAGAAGATACAATTTGAAGAAGG + Intronic
1018227948 6:161647565-161647587 AGGAATATACTCTCTGAGTATGG - Intronic
1020538421 7:9429926-9429948 AGCAAAGTACACTTTGAAGAGGG + Intergenic
1020608913 7:10371187-10371209 AGGAATATACTTAATGAAGGAGG + Intergenic
1020758898 7:12242716-12242738 AAGAAGATACTCGTTGAAGAAGG - Exonic
1020978221 7:15034535-15034557 TGGAATATACTTTTTAAAAATGG - Intergenic
1022584051 7:31588041-31588063 AGGAATCTACTCATTGGAGATGG - Intronic
1022736304 7:33079487-33079509 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1024460790 7:49657402-49657424 AGGAATATTCCCTTCGAGGAGGG + Intergenic
1024693461 7:51828726-51828748 GAGAAGATACTCTTTGAAAAGGG + Intergenic
1026258295 7:68732001-68732023 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1026730777 7:72910214-72910236 AGGAAAGTACACTTGGAAGAAGG - Intronic
1027113312 7:75457956-75457978 AGGAAAGTACACTTGGAAGAAGG + Intronic
1027285562 7:76642551-76642573 AGGAAAGTACACTTGGAAGAAGG + Intergenic
1027662715 7:81006285-81006307 AGGAATATAACCTTTTAAAATGG + Intergenic
1027879896 7:83821469-83821491 AGGTGTTTCCTCTTTGAAGAGGG - Intergenic
1028879164 7:95859989-95860011 AAGAAAATACACATTGAAGAGGG - Intronic
1030529118 7:110690747-110690769 AGGAATATACTTTACCAAGAAGG + Intronic
1030558215 7:111053149-111053171 AGGAAAGTACACTTGGAAGAGGG + Intronic
1030748914 7:113205276-113205298 TGGAAAATCCTCTTTCAAGATGG - Intergenic
1032701412 7:134383069-134383091 GAGAATAAACTTTTTGAAGAAGG - Intergenic
1033426242 7:141246908-141246930 AGCAATAAGCTCTTTAAAGAAGG - Intronic
1035160646 7:156948093-156948115 AGCAATATACTCTATGTACAGGG - Intergenic
1035401967 7:158571599-158571621 AGGAAAGTACACTTGGAAGAGGG + Intronic
1036002093 8:4617813-4617835 ATGAATATACTCATGGAGGAGGG - Intronic
1037962474 8:23108208-23108230 AGGAAAGTACACTTGGAAGATGG + Intronic
1038390329 8:27192433-27192455 AAGAATATAATCTGTGATGAGGG + Intergenic
1038605181 8:28994484-28994506 ATGAATATACTTTTTAAAGCTGG + Intronic
1038869805 8:31481669-31481691 AGGAAAGTACACTTGGAAGAGGG + Intergenic
1038958092 8:32489023-32489045 AGTAAAATACACTTGGAAGAGGG + Intronic
1040087407 8:43359746-43359768 AGGAATATACTTAATGAAGGAGG - Intergenic
1040405090 8:47093201-47093223 AGGAATATACTTAATGAAGGAGG + Intergenic
1040775054 8:51032540-51032562 AGGATTATATTCTCTGAAAATGG - Intergenic
1041385651 8:57299126-57299148 AGTAAAATACACTTGGAAGAGGG + Intergenic
1041808503 8:61882008-61882030 ATGAATAGACACATTGAAGAGGG - Intergenic
1043344577 8:79285250-79285272 AGTAAAGTACTCTTGGAAGAGGG + Intergenic
1043885151 8:85590300-85590322 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1044385965 8:91588476-91588498 GGGAATAGACACATTGAAGAGGG - Intergenic
1044691050 8:94878829-94878851 AGGAATAAAGACTTTCAAGAAGG - Intronic
1045270373 8:100656256-100656278 AGGAAAGTACACTTGGAAGAGGG - Intronic
1046386921 8:113518038-113518060 AGTAATATACACTTGGATGAGGG - Intergenic
1047826790 8:128584902-128584924 AGGTACATACTCTTTGGTGACGG + Intergenic
1048896054 8:138993407-138993429 AGGAATATACTCAAAGAAGGTGG + Intergenic
1050217889 9:3348543-3348565 AGGAATTTATTCTTTATAGAAGG - Intronic
1050564678 9:6869710-6869732 AAGAACATACCCCTTGAAGAGGG - Intronic
1050740123 9:8810354-8810376 AGGAAGATAACCTTTGAAGAAGG - Intronic
1050894933 9:10874409-10874431 AAGATGATACTCTTTGAAGAAGG + Intergenic
1051179107 9:14391820-14391842 AGCAAAGTACTCTTGGAAGAGGG - Intronic
1051557977 9:18406223-18406245 ATGAGCATACTCTTTGAATAGGG - Intergenic
1051565083 9:18488412-18488434 AGGTCTATACTCATTGAAGTAGG - Intronic
1053252976 9:36590479-36590501 AGGAAAACACCATTTGAAGACGG - Intronic
1053441559 9:38120560-38120582 CGGAATAGACTCTTAGAAGAAGG + Intergenic
1054824500 9:69559218-69559240 AAGAATATATTTTTTAAAGATGG - Intronic
1058468478 9:105252758-105252780 GGGAATTCACTCTGTGAAGATGG + Intronic
1061786610 9:133032454-133032476 AGGAAGTTAGACTTTGAAGATGG + Intronic
1061787390 9:133038152-133038174 AGGAAGTTAGACTTTGAAGATGG + Intronic
1203528337 Un_GL000213v1:111201-111223 AGGAATATACTTAATGAAGGAGG + Intergenic
1185805194 X:3050587-3050609 AGGAAAGTACACTTGGAAGATGG + Intronic
1185914824 X:4024274-4024296 AGGTATATCCTCTGTGATGAGGG + Intergenic
1186035740 X:5421680-5421702 AGCAAAATACACTTGGAAGAGGG + Intergenic
1186380095 X:9048875-9048897 AGGAAGCTTCTCTCTGAAGAGGG - Intronic
1187260988 X:17685091-17685113 AGGAATAGATTTTTTAAAGAAGG + Intronic
1187529579 X:20084299-20084321 AGGTGTATACACTGTGAAGAAGG - Intronic
1188650028 X:32621202-32621224 AGGTATAAACTCTTTCTAGACGG + Intronic
1188989788 X:36803481-36803503 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1193377055 X:80773905-80773927 AGGAATTTACTCTTTGGAGAAGG - Intronic
1194169708 X:90566078-90566100 AGTAATGTACACTTGGAAGAGGG + Intergenic
1194635129 X:96336721-96336743 AGGAATAGACACTTTGCAAAAGG - Intergenic
1194850747 X:98865480-98865502 AGGAAAGTACACTTGGAAGAGGG - Intergenic
1194876185 X:99191031-99191053 AGGAAAATACGTTTTGAAGAAGG - Intergenic
1195535508 X:106004596-106004618 AGGAATATTTTCTTTCATGATGG + Intergenic
1195798355 X:108678971-108678993 AGGAATATTCTATTTAAAAATGG - Intronic
1198078468 X:133216403-133216425 AGGAATAGACTCTTGATAGAAGG - Intergenic
1198267826 X:135026507-135026529 AGGAATATACTTAATGAAGGAGG + Intergenic
1198582560 X:138082100-138082122 GGGAATAGACTCTTTGCAGGAGG + Intergenic
1198979995 X:142384418-142384440 AGGAATAGTATCTTGGAAGAAGG + Intergenic
1199242647 X:145565733-145565755 AGGAATATACCCATTTAAGAGGG - Intergenic
1200515948 Y:4143853-4143875 AGTAATGTACACTTGGAAGAGGG + Intergenic
1201276071 Y:12300017-12300039 AGGAAAGTACACTTGGAAGACGG - Intergenic
1201406269 Y:13653303-13653325 AGGAATATACTCTGGGAATTAGG - Intergenic