ID: 1130243378

View in Genome Browser
Species Human (GRCh38)
Location 15:82219722-82219744
Sequence GCATTTGCTCGGGTGTTCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130243378_1130243386 24 Left 1130243378 15:82219722-82219744 CCACTGAACACCCGAGCAAATGC 0: 2
1: 0
2: 0
3: 4
4: 82
Right 1130243386 15:82219769-82219791 TTCCTGGAGCACAGGTTTAGGGG 0: 1
1: 1
2: 3
3: 16
4: 302
1130243378_1130243383 16 Left 1130243378 15:82219722-82219744 CCACTGAACACCCGAGCAAATGC 0: 2
1: 0
2: 0
3: 4
4: 82
Right 1130243383 15:82219761-82219783 TTGTTTTCTTCCTGGAGCACAGG 0: 2
1: 1
2: 1
3: 37
4: 456
1130243378_1130243382 8 Left 1130243378 15:82219722-82219744 CCACTGAACACCCGAGCAAATGC 0: 2
1: 0
2: 0
3: 4
4: 82
Right 1130243382 15:82219753-82219775 ACTCTTGGTTGTTTTCTTCCTGG 0: 2
1: 0
2: 3
3: 29
4: 306
1130243378_1130243385 23 Left 1130243378 15:82219722-82219744 CCACTGAACACCCGAGCAAATGC 0: 2
1: 0
2: 0
3: 4
4: 82
Right 1130243385 15:82219768-82219790 CTTCCTGGAGCACAGGTTTAGGG 0: 1
1: 1
2: 3
3: 17
4: 229
1130243378_1130243381 -7 Left 1130243378 15:82219722-82219744 CCACTGAACACCCGAGCAAATGC 0: 2
1: 0
2: 0
3: 4
4: 82
Right 1130243381 15:82219738-82219760 CAAATGCAATAAAAGACTCTTGG 0: 1
1: 1
2: 2
3: 23
4: 296
1130243378_1130243384 22 Left 1130243378 15:82219722-82219744 CCACTGAACACCCGAGCAAATGC 0: 2
1: 0
2: 0
3: 4
4: 82
Right 1130243384 15:82219767-82219789 TCTTCCTGGAGCACAGGTTTAGG 0: 2
1: 0
2: 1
3: 28
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130243378 Original CRISPR GCATTTGCTCGGGTGTTCAG TGG (reversed) Exonic
900694358 1:4000677-4000699 GCACTGGCTCGGGTGCTCTGGGG + Intergenic
903163325 1:21504363-21504385 GCATTAAATAGGGTGTTCAGTGG - Intergenic
910753378 1:90658931-90658953 GCATTTGGTCTGGTGATTAGAGG - Intergenic
914077530 1:144369468-144369490 GTATTTGCTAGAGTGTTTAGGGG + Intergenic
914101649 1:144597037-144597059 GTATTTGCTAGAGTGTTTAGGGG - Intergenic
914172440 1:145238009-145238031 GTATTTGCTAGAGTGTTTAGGGG + Intergenic
914297315 1:146340474-146340496 GTATTTGCTAGAGTGTTTAGGGG + Intergenic
914527081 1:148479011-148479033 GTATTTGCTAGAGTGTTTAGGGG + Intergenic
914639316 1:149588124-149588146 GTATTTGCTAGAGTGTTTAGGGG - Intergenic
918074863 1:181162211-181162233 GTATTTGCCTGGCTGTTCAGAGG + Intergenic
921819361 1:219599581-219599603 TCATTTGAACGGGTATTCAGTGG + Intergenic
923048500 1:230373152-230373174 GCTTTTGCTCAGGTGCTCACAGG + Intronic
1063216857 10:3932618-3932640 GCCTCTGCTTGGGTGTTCATGGG + Intergenic
1064095630 10:12422528-12422550 GCATTTGGCCAGGTGTTCAGGGG - Intronic
1070671842 10:78382967-78382989 GCATCTGCTGGCGTGTTCAGTGG - Intergenic
1074897369 10:117788973-117788995 GCACTTGGTGGGGTCTTCAGGGG - Intergenic
1079285642 11:19129070-19129092 GCATTTTTTGGTGTGTTCAGTGG - Intronic
1084788081 11:71455311-71455333 GCCCTTGCTCAGGTGTTCAATGG - Intronic
1084798890 11:71528039-71528061 GCCTTTGCTTGTGTATTCAGAGG + Exonic
1086146595 11:83559246-83559268 GGGTTTGCTTGGGTGTGCAGGGG + Intronic
1095154624 12:38837432-38837454 GCATTTGCTAAGGTATCCAGAGG + Intronic
1098842226 12:75490094-75490116 GATTTTACTTGGGTGTTCAGAGG - Intronic
1104978827 12:132563886-132563908 ACAGGTGCTCGGGGGTTCAGGGG - Intronic
1111461558 13:88549915-88549937 ACAGTTACTGGGGTGTTCAGAGG - Intergenic
1113606518 13:111611326-111611348 ACATTAGCTGAGGTGTTCAGTGG + Intronic
1120196857 14:81494101-81494123 GCATTGGATAGTGTGTTCAGAGG - Intronic
1121901711 14:97698701-97698723 GCATTTGCTCCGGTGTCTGGTGG - Intergenic
1125157643 15:36607014-36607036 GCATTTTCTGGGTTGATCAGTGG + Intronic
1125962366 15:43842183-43842205 TCATTTGCTAGGTTGTTGAGAGG + Intronic
1129929268 15:79396107-79396129 GCATTTGTTCTGGAATTCAGAGG - Intronic
1130243378 15:82219722-82219744 GCATTTGCTCGGGTGTTCAGTGG - Exonic
1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG + Intergenic
1130561517 15:84963003-84963025 GCATTTGCTAGTGTGACCAGTGG + Intergenic
1137350355 16:47708442-47708464 GCATTTGCTTGGGATTTCAATGG + Intergenic
1137516659 16:49150331-49150353 CAATTTGCTCCAGTGTTCAGTGG + Intergenic
1141307605 16:82881180-82881202 GCATGTGCTTGGGTGTGTAGAGG + Intronic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1149625767 17:58079690-58079712 GCATTCCCTCTGGGGTTCAGGGG + Intergenic
1156477226 18:37413373-37413395 GCATTTGCTCTGGAGCTCCGTGG + Intronic
1164921198 19:32089969-32089991 GGCTTTGCTGGGGTCTTCAGGGG - Intergenic
1165057541 19:33187502-33187524 GCATTTCCTCCTGAGTTCAGTGG - Intronic
926382621 2:12305512-12305534 CAAGCTGCTCGGGTGTTCAGGGG + Intergenic
947047058 2:225999583-225999605 GCTTTTGCTCTTGTGTGCAGTGG - Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1179260881 21:39757364-39757386 GCATTTGGTCAGGCATTCAGAGG + Intronic
1179484865 21:41703864-41703886 ACATTCGCTCAGGTGTTCAGGGG - Intergenic
1183359931 22:37378195-37378217 GCATGTGCTTGTGTGTGCAGGGG + Intronic
953850767 3:46464159-46464181 GTAATTTCTCGGGTGCTCAGAGG - Intronic
959585015 3:108017782-108017804 ACAACTGCTTGGGTGTTCAGCGG - Intergenic
961328454 3:126125346-126125368 GCAGCTGCTCGGGTGAGCAGAGG - Intronic
963674637 3:148294369-148294391 GCATTTACTCGGGAGTGCACTGG + Intergenic
981178827 4:141715076-141715098 CCATCTTCTCAGGTGTTCAGAGG + Intronic
989809477 5:45656214-45656236 GCATTTGCTAAGGAGTTCCGGGG + Intronic
989980445 5:50637333-50637355 GTATTTGCTAGAGTGTTTAGGGG - Intergenic
1000865325 5:166506999-166507021 GCATTTGCTGGGGGTGTCAGTGG - Intergenic
1001364213 5:171121198-171121220 GCAGTTGCTCGGCTGTCCTGGGG + Intronic
1001601363 5:172930950-172930972 GACTTTTCTCGGGTTTTCAGAGG + Intronic
1003692804 6:8371494-8371516 GCATTTGCTCAGGTCTTCGATGG - Intergenic
1008621272 6:53273757-53273779 ACATTTGCTGGGGTGTGGAGAGG + Intronic
1008645512 6:53510149-53510171 GTTTTGGCTTGGGTGTTCAGAGG + Intronic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009566293 6:65315008-65315030 TCATTTGAACGGGTATTCAGTGG - Intronic
1022371790 7:29778265-29778287 GCCTTGGCTAAGGTGTTCAGAGG + Intergenic
1035248366 7:157580577-157580599 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248382 7:157580625-157580647 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248391 7:157580657-157580679 GCAGGGGCTCGGGTGTTCAGGGG - Intronic
1035248425 7:157580785-157580807 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248448 7:157580865-157580887 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248471 7:157580945-157580967 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248479 7:157580977-157580999 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248488 7:157581009-157581031 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248500 7:157581052-157581074 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1036432872 8:8706062-8706084 GCAGTTGCTGGGCTGGTCAGTGG - Intergenic
1043472057 8:80572958-80572980 GCAGTTGATCATGTGTTCAGAGG + Intergenic
1046632392 8:116634001-116634023 GCAGTTGCGTGGGTGTTCTGGGG - Intergenic
1053617810 9:39787524-39787546 GTATTTGCTCTGGTGTTGGGTGG + Intergenic
1053896664 9:42747746-42747768 GTATTTGCTCTGGTGTTGGGTGG - Intergenic
1054266350 9:62919907-62919929 GTATTTGCTCTGGTGTTGGGTGG - Intergenic
1057895700 9:98906950-98906972 CCCTTTGCCAGGGTGTTCAGAGG - Intergenic
1058162367 9:101583340-101583362 ACATTTTCTCTGGTGTTCACAGG - Intronic
1060429431 9:123536653-123536675 GCATTTTCTCGGGAGTTCCTAGG - Intronic
1185734153 X:2484859-2484881 TCATTTGCTCGTGAGTGCAGAGG - Intronic
1192546154 X:72016776-72016798 ACACTTGCTCTGCTGTTCAGTGG + Intergenic