ID: 1130245618

View in Genome Browser
Species Human (GRCh38)
Location 15:82245643-82245665
Sequence GTCAAAACTGAGATGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 2, 1: 0, 2: 2, 3: 21, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130245613_1130245618 18 Left 1130245613 15:82245602-82245624 CCACAAGGAGAGGTGAAGGGTGG 0: 2
1: 0
2: 3
3: 27
4: 256
Right 1130245618 15:82245643-82245665 GTCAAAACTGAGATGGGGTCAGG 0: 2
1: 0
2: 2
3: 21
4: 179
1130245610_1130245618 22 Left 1130245610 15:82245598-82245620 CCTGCCACAAGGAGAGGTGAAGG 0: 1
1: 0
2: 3
3: 15
4: 233
Right 1130245618 15:82245643-82245665 GTCAAAACTGAGATGGGGTCAGG 0: 2
1: 0
2: 2
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130245618 Original CRISPR GTCAAAACTGAGATGGGGTC AGG Intronic
900708118 1:4093404-4093426 GTCATAACTGTGATGTGGTTTGG - Intergenic
900777354 1:4594841-4594863 GTCAAAACTGAGAGAGAGCCTGG - Intergenic
902606428 1:17571949-17571971 GCCAGAAATGAGATGGGGTAAGG - Intronic
903477029 1:23626623-23626645 GACAAAACTGATGTGGAGTCAGG + Intronic
904813625 1:33180369-33180391 GTTAAGACTGAGATCAGGTCCGG - Intronic
907020669 1:51064092-51064114 GTCAAAACTTATATGTGGCCAGG + Intergenic
907983233 1:59505501-59505523 GGCAAAACTGAGCTGGGGGCTGG + Intronic
908979708 1:69941021-69941043 GTAAAAACTGAAAGGAGGTCAGG + Intronic
910267676 1:85356656-85356678 TTCAAAACTGAGATGATGTTGGG - Intronic
913161401 1:116149087-116149109 ATCAAGACTGAGGTGGGGTGGGG - Intergenic
916945556 1:169722956-169722978 GTCAAAACAGAGATGTGATAAGG - Exonic
917232101 1:172848677-172848699 GTCAAATATGAGATGGTGTTTGG - Intergenic
920802493 1:209202498-209202520 GTTAAAACTGTGGTGGGGCCTGG + Intergenic
921320919 1:213937651-213937673 GCAAAATCTGAGATTGGGTCAGG - Intergenic
922453004 1:225751654-225751676 TTCAAAACTGGGAATGGGTCAGG + Intergenic
923071869 1:230573056-230573078 GTCTAAACTGTGAAGGGGTGGGG + Intergenic
923188300 1:231595580-231595602 GGCAAAACTTAGAAAGGGTCAGG + Intronic
923750766 1:236744422-236744444 TTCAAAACTGAGAAGGGGCTGGG + Intronic
923856255 1:237848444-237848466 GTCAAAACTGAAGAGGGGCCGGG - Intergenic
924257688 1:242198642-242198664 GTCTAAACTGAGATGTGCTGTGG + Intronic
924685700 1:246287674-246287696 GCCAAAACAGAGACAGGGTCAGG - Intronic
1063186996 10:3660569-3660591 GTCGAAAGTCAGATGGGGGCAGG + Intergenic
1065420099 10:25533826-25533848 GTTTAAACTCAGCTGGGGTCTGG - Intronic
1065765576 10:29026462-29026484 GTCAACAATGGGAGGGGGTCTGG - Intergenic
1069149229 10:64934620-64934642 GTCAAAAATGAGATGTTTTCTGG - Intergenic
1069230278 10:66000275-66000297 GCCAGAAATGAGATGAGGTCAGG - Intronic
1069895185 10:71676200-71676222 GTTAAAAGTGAGAGGGGGCCGGG - Intronic
1070507881 10:77131519-77131541 GGCAAAACTGATATATGGTCAGG + Intronic
1071968085 10:90873067-90873089 TTCAAAAATGGGATGGCGTCAGG - Intronic
1073586896 10:104719140-104719162 GTCAGAATTGAGATGGGCTTAGG - Intronic
1074132133 10:110589092-110589114 TTAAAAACTGAAATGGGGCCGGG + Intronic
1075726204 10:124612105-124612127 GTCAAGACTGGGATGGGGGCCGG + Intronic
1075947846 10:126453716-126453738 GTAATAACTGAGCTGGGCTCTGG - Intronic
1076348683 10:129799582-129799604 CTCTGAACTGAGATGGTGTCGGG + Intergenic
1076644492 10:131943281-131943303 CTCAACACAGAGATGGGGGCGGG + Intronic
1076736722 10:132462331-132462353 GACAAAACTGAGGAGGGGGCGGG + Intergenic
1077237838 11:1490599-1490621 TTCAAAACTGAGACCTGGTCAGG + Intronic
1083358762 11:62089866-62089888 GTCAAATATGAAATGGGGTTTGG + Intergenic
1086330169 11:85746063-85746085 ATCTGAACTGAGTTGGGGTCAGG + Intronic
1089249189 11:117145080-117145102 GTCTAAGATGAGATGGGGGCTGG - Intronic
1090730813 11:129572101-129572123 GTCAGCACTGGGCTGGGGTCAGG + Intergenic
1093708370 12:22300915-22300937 GTCAAATCTGAAATGGTGTTTGG + Intronic
1093754720 12:22839800-22839822 GTCAAAGATGACATGGGGTGGGG - Intergenic
1095902288 12:47340504-47340526 GTCAACACTGAGCTGAGGTTTGG + Intergenic
1097191310 12:57220861-57220883 GGCAAAACAGAGATGGGGGATGG - Intronic
1099063282 12:77940279-77940301 GGAAAAAGTGAGATGGGGTGAGG - Intronic
1099868495 12:88316096-88316118 GTCAAAGCTCAGATGGATTCAGG + Intergenic
1101613787 12:106316388-106316410 GACAGCACTGAGATGGGGTCAGG - Intronic
1101779267 12:107821253-107821275 GTCACAACTGGGTAGGGGTCAGG - Intergenic
1105932210 13:25063120-25063142 GAGAAAACTGAGGTGGGCTCAGG - Intergenic
1106004206 13:25753331-25753353 GTCAGCACTGAGCTGGGGGCTGG - Intronic
1106132287 13:26950589-26950611 CTCAAAAGTGTTATGGGGTCTGG + Intergenic
1106625000 13:31411187-31411209 GTCAAAACTGTGTTGAGGCCGGG - Intergenic
1107078834 13:36352648-36352670 GTGAAAACTGAGAAGAGGCCAGG + Intronic
1112045992 13:95598595-95598617 GTCAATACTTATATGGGTTCTGG - Intronic
1113370897 13:109724558-109724580 GTGAAAGCAGAGATGGGGTGAGG + Intergenic
1116724247 14:48542014-48542036 TTTAAAACTCAGATGAGGTCAGG - Intergenic
1116891916 14:50276976-50276998 GTCACAACTGGGATGGGGGAGGG - Intronic
1119065752 14:71524742-71524764 GCTAAAACTGAGATGTGGCCAGG - Intronic
1119401944 14:74368710-74368732 GACCAACTTGAGATGGGGTCTGG - Intergenic
1122241259 14:100369252-100369274 GTCAAGACTGGGGTGGGGGCGGG + Exonic
1122558914 14:102597167-102597189 CTCAAAACTGAGGTAGGGACAGG - Intronic
1123632827 15:22273927-22273949 GTCAAAACTGAAGTGGTGGCCGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1127762482 15:62152389-62152411 GTCAACACTGCGATGGGGTCAGG + Intergenic
1128758817 15:70200969-70200991 TTCAAAACAGAGATGAGATCTGG + Intergenic
1129085287 15:73083200-73083222 GGCAAAACTGAAAAGAGGTCAGG + Intronic
1129876239 15:78977429-78977451 AACAAAACTGCGATGGGGTGGGG + Intronic
1130245618 15:82245643-82245665 GTCAAAACTGAGATGGGGTCAGG + Intronic
1130455078 15:84097738-84097760 GTCAAAACTGAGATGGGGTCAGG - Intergenic
1131770921 15:95736515-95736537 GTCAAATTTGAGGAGGGGTCTGG - Intergenic
1132515642 16:364545-364567 GGCCAGACTGAGGTGGGGTCTGG - Intergenic
1133226658 16:4344160-4344182 CTCAAGACTGAGATGGGATTCGG + Intronic
1135129636 16:19842139-19842161 TTCAAAAATGATATGGGGCCGGG - Intronic
1137690255 16:50421397-50421419 GCCAATGCTGAGATGGGGACTGG + Intergenic
1137955712 16:52827096-52827118 CTCAAAACTGAGCTGGGTGCTGG + Intergenic
1139185427 16:64800726-64800748 TTCAAAGCTGGGATGGAGTCTGG + Intergenic
1140888278 16:79263306-79263328 GTCAAGACAGAGATGGGGAATGG + Intergenic
1141895902 16:86958702-86958724 CTCAAAACTGGGCTGGTGTCAGG - Intergenic
1141970232 16:87476828-87476850 GTCAAAACTGAAGTGGTGGCCGG + Intronic
1143375627 17:6465339-6465361 GTCAAAACAGAGAACGGGCCAGG - Intronic
1148853758 17:50567442-50567464 GTCAGAACAGAGATGGGCTATGG + Intronic
1153706002 18:7746759-7746781 GTCAAGACTATGATGGGGCCAGG - Intronic
1153799683 18:8658336-8658358 GTCAAGAATGAGATTGGGTGTGG + Intergenic
1154929870 18:20982010-20982032 ATCAGAACTGAGATAGGGTCAGG + Intronic
1156370321 18:36467029-36467051 GTCCAAACTGAGATGGGGCAGGG - Intronic
1157336076 18:46738540-46738562 TGCAAAACTGAGATGAGGTGAGG - Intronic
1157634743 18:49140897-49140919 GGCAAAACAGAGGTGGTGTCTGG - Intronic
1157897771 18:51484915-51484937 GTCATAACTGGGATGGGGGCTGG + Intergenic
1158932275 18:62333705-62333727 GTCAACTCTGTGATGGGGTAGGG + Intronic
1162866755 19:13553875-13553897 GGAAAAACTGAAATGGTGTCTGG + Intronic
1162951457 19:14073997-14074019 GACAAAATTGAGAGGGGGTCTGG - Intronic
1163556425 19:17995879-17995901 GTCAAAACTTATATGAGGCCGGG - Intronic
1163762001 19:19142330-19142352 GACAAACCTTAGCTGGGGTCTGG + Intergenic
1165004394 19:32792890-32792912 GTCAAAATTCTGATGAGGTCAGG + Intronic
1166653435 19:44592630-44592652 GCCAAAACCGAGATGGTGACAGG + Intergenic
1166767616 19:45261606-45261628 TTTAAAACAGAGATGGGGCCAGG - Intronic
925094286 2:1183048-1183070 GTCAAAATAGAGATTAGGTCAGG - Intronic
926790543 2:16567021-16567043 GTTAAAACTGAGATTTGATCTGG - Intronic
928677978 2:33668894-33668916 GTCAAAAAAGAGATGAGGGCTGG + Intergenic
929788469 2:45008100-45008122 GGCCAAAGTGTGATGGGGTCGGG - Intronic
930053859 2:47237240-47237262 CTCAAAAATGAGCTGGGGCCGGG + Intergenic
930076970 2:47413997-47414019 ATCAAAACTAAAATGGGGGCCGG - Intronic
930517690 2:52429242-52429264 GTTAATACTGAGATGGGGTAGGG + Intergenic
932614455 2:73223177-73223199 TTCAAGACTGGGATGGGGTAGGG + Intronic
932824323 2:74925860-74925882 GCCAAAACAGAGTTGGGGGCAGG + Intergenic
935219155 2:100997383-100997405 GTCAAGACTGAGATGTTGGCTGG - Intergenic
935374083 2:102377716-102377738 GTCAAAAAGGAGATGAGGTGAGG - Intronic
936034353 2:109098873-109098895 CTCAAATCTCAGATGGGTTCAGG + Intergenic
937685563 2:124692567-124692589 GTCACAAGTGATATGAGGTCAGG + Intronic
937934753 2:127234227-127234249 GTCAAAAATGAAATTGGGCCAGG - Intergenic
940150244 2:150592202-150592224 GTCACAACTGGGATGGGGGGTGG - Intergenic
942604830 2:177679671-177679693 GAGAAAACTATGATGGGGTCTGG + Intronic
946212996 2:218162472-218162494 ATCAAAGCTGGGATGGGGGCAGG - Intergenic
947030925 2:225793957-225793979 GGCAAATTTGAGATGGGGGCTGG + Intergenic
1169185298 20:3610890-3610912 GTCAAAAATCAGCTGGGGGCTGG - Intronic
1170510073 20:17067449-17067471 GTCAAAAGTGAGGTTGGGACAGG + Intergenic
1172480407 20:35267970-35267992 GTGAACTCTGAGGTGGGGTCTGG + Intronic
1172705425 20:36879030-36879052 GTGAAAGCTGAGCTGGGGACAGG - Exonic
1178020695 21:28405091-28405113 GTCAAAACTTACATGGGTTTAGG + Intergenic
1178114689 21:29405179-29405201 GTCAAGGCTGAGATGGTCTCAGG + Intronic
1179230738 21:39501876-39501898 TTAAAAGCTGAGATGGGGCCGGG + Intronic
1181446793 22:22982872-22982894 GTCACAACTGAGTAGGGGCCAGG - Intergenic
1185260344 22:49858196-49858218 GGCTAAACTGAGAAGGGGGCCGG - Intronic
1185296345 22:50057137-50057159 GTCAGGTCTGAGTTGGGGTCAGG + Intergenic
951083328 3:18478872-18478894 GTCAAAACTTAGATTGGATCTGG - Intergenic
951281954 3:20761997-20762019 TTAAAAACTGAGATGGGGGGGGG - Intergenic
951454042 3:22870852-22870874 TTCAGAACTTAGTTGGGGTCTGG - Intergenic
952189483 3:31007575-31007597 GTGAAAATTGAGATGGAATCCGG + Intergenic
953055733 3:39385781-39385803 GTCATAAGGGAGATGGGGACAGG + Intronic
954817948 3:53298590-53298612 GTTAGAACTGAGTTGGAGTCTGG - Intronic
955164024 3:56492874-56492896 TTTAAAAGTGAGATGGGGCCAGG - Intergenic
955254063 3:57311600-57311622 GTCACAACTGTGGTGGGGGCTGG + Intronic
957990651 3:87622963-87622985 AACAAAACTGAAATGGGGTCAGG + Intergenic
962157547 3:132964239-132964261 GTCAAAACTGACAATGGGACTGG - Intergenic
968556835 4:1249788-1249810 GTTAAAAGAGAAATGGGGTCGGG - Intronic
970459894 4:16263056-16263078 GTCAAAACTAATATGGCGCCTGG - Intergenic
971222928 4:24725620-24725642 GACAGAACTGAGATGGGGGGAGG - Intergenic
972838670 4:42905666-42905688 GTCAAAACTGAAAGGGAGTGTGG + Intronic
973818105 4:54637278-54637300 TGCAAGACTGAGATGGCGTCAGG + Intergenic
979800814 4:124906472-124906494 GTCAAAGCAGAGATGAGGACAGG - Intergenic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
984333539 4:178358139-178358161 GACAAAACAAAGATGAGGTCAGG - Intergenic
985132001 4:186748163-186748185 GTAAGAGCTGAGATGGGGCCTGG - Intergenic
985653379 5:1117334-1117356 GTCAGAACCAAGATGGAGTCAGG - Intergenic
987774401 5:22345805-22345827 GTCAAAAAGGAGAATGGGTCCGG + Intronic
988896448 5:35679373-35679395 ATCAAAACTGAGATTGGGTGAGG + Intronic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
991090146 5:62686509-62686531 GTTACATTTGAGATGGGGTCTGG - Intergenic
995130953 5:108629991-108630013 GTCAAGACTGAGGTGGTGTCAGG + Intergenic
998437151 5:142120713-142120735 GCCACAACTGATGTGGGGTCTGG - Intronic
1000202431 5:159024886-159024908 GTTAAAACTGAGCTGGAGCCTGG + Intronic
1000329807 5:160197662-160197684 GTCATAACTGAGGAGGGGGCAGG - Intronic
1003793246 6:9570855-9570877 GTATAAACTGAGATGGTTTCAGG + Intergenic
1006480490 6:34289268-34289290 GTAAAAACTGACATGAGGGCCGG + Intronic
1007462465 6:42028425-42028447 GACAAAAATGAGATGGGCACAGG - Intronic
1010445899 6:75948469-75948491 GTCAAAATTGTGGTGGGGTGGGG - Intronic
1010768860 6:79805851-79805873 GTCAGAACTGTCATGGGGTAGGG + Intergenic
1012045756 6:94270995-94271017 TTCAAAACTGAGATGTAGGCAGG + Intergenic
1013021189 6:106221393-106221415 GTCAAAACTGAGGCCGGGTACGG + Intronic
1013567200 6:111378582-111378604 GTAAAAACAGAGATTGTGTCAGG - Intronic
1015653613 6:135492637-135492659 GTCAATCCTGAGATGGAGTTTGG - Intronic
1015730088 6:136338553-136338575 ATCAAAAAAGAGATGGGGTCAGG - Intergenic
1019422797 7:958836-958858 TTCCAAACAGAGATGGGGTCTGG + Intronic
1020552490 7:9624658-9624680 GTCAAGAGTGAGATCAGGTCTGG + Intergenic
1022526700 7:31042718-31042740 GGCCAAACTGAGATGGAGTCAGG + Intergenic
1023582664 7:41699567-41699589 ATAAAAACTTGGATGGGGTCCGG + Intronic
1024061433 7:45701851-45701873 GTCAGACCAGAGCTGGGGTCTGG - Intronic
1029202434 7:98848022-98848044 GTTAACACTGAGATGGGGTGGGG + Exonic
1029262636 7:99313619-99313641 GTCAAAACTGGAATGGGGCCGGG - Intergenic
1030147909 7:106375060-106375082 TTCAAAACTGAGATCAGTTCAGG - Intergenic
1030532869 7:110732054-110732076 GTCAAAGCTGAGACTGGGTGGGG + Intronic
1033150589 7:138911832-138911854 GTCCAAACGGAGATGGGCTGTGG - Intronic
1035028493 7:155842684-155842706 GTCAGCACTGAGATGGGGGCAGG + Intergenic
1035372723 7:158389803-158389825 GTGAAAACTAAGATGTGGCCAGG - Intronic
1035456651 7:159013464-159013486 GTCAAGGTTGGGATGGGGTCTGG + Intergenic
1036559443 8:9889085-9889107 GTCAAAACTGCACTGGAGTCTGG + Intergenic
1037539477 8:19857413-19857435 GTCAAAAATGAGGGAGGGTCTGG - Intergenic
1037722355 8:21455572-21455594 GTAAAATGTGAGATGTGGTCTGG + Intergenic
1040547428 8:48409676-48409698 ATAAGGACTGAGATGGGGTCAGG - Intergenic
1041846438 8:62334714-62334736 GTCAAAATTTGGATGGGGTTTGG + Intronic
1041981052 8:63860222-63860244 GTCAAAACTCATTTGGGGCCGGG + Intergenic
1042416106 8:68521407-68521429 GTAGAAACTGGGTTGGGGTCAGG - Intronic
1043094580 8:75950489-75950511 GTCAAAACTGAGACAGGGCTTGG + Intergenic
1043242771 8:77957130-77957152 GTTAAAACTGATTTGGGGCCGGG + Intergenic
1044741232 8:95328423-95328445 GTCAAGACTGAGTTGGGGGCTGG - Intergenic
1045652811 8:104357223-104357245 GTTAAAAGTGATATGGGGGCTGG - Intronic
1047140980 8:122139303-122139325 GTGAAAACTGGAAGGGGGTCTGG + Intergenic
1049608185 8:143539411-143539433 CTCAGAAGTGAGATGGGATCTGG - Intronic
1050764012 9:9110033-9110055 GTCAAGGCTTAGATGGGGACAGG + Intronic
1053008811 9:34621979-34622001 GTCTACACTGGCATGGGGTCAGG - Intronic
1055964140 9:81848994-81849016 GTCAAAACTGAGGTGAGAACAGG + Intergenic
1056151701 9:83796760-83796782 ATTAAAACTGAGATGGGGCCGGG - Intronic
1057468917 9:95340402-95340424 ATCAAAACTGTAATGAGGTCAGG + Intergenic
1062466834 9:136685321-136685343 CTCCAAGCTGAGATGGGGACAGG + Intronic
1187324379 X:18273191-18273213 CTCAAAACTGAGGTGGGGATGGG - Intronic
1188776596 X:34227211-34227233 GTGAAGACTGATATGGGTTCGGG - Intergenic
1192197905 X:69042885-69042907 GTCAAAAATCAGTTGGGGGCTGG + Intergenic
1198025185 X:132698642-132698664 ATCAAAAATGATATGGGGCCAGG - Intronic
1198276576 X:135099651-135099673 GTGAAAACTGGGATGGGGTCGGG - Intergenic
1198309918 X:135421086-135421108 GTGAAAACTGGGATGGGGTTGGG + Intergenic
1199429190 X:147739841-147739863 GTCAGGACTGAAATGGGGTGGGG + Intergenic
1200232730 X:154452253-154452275 GTCAAAAGTGAGCTGGAGGCCGG + Intergenic
1201268969 Y:12236000-12236022 GTCAAGACTTAGAAGGGGCCGGG - Intergenic